SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma06g02400

Feature Type:gene_model
Chromosome:Gm06
Start:1608458
stop:1609570
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma06g02400
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G20225AT Annotation by Michelle Graham. TAIR10: Thioredoxin superfamily protein | chr1:7007966-7009318 REVERSE LENGTH=233 SoyBaseE_val: 3.00E-21ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_I1K7G9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K7G9_SOYBN SoyBaseE_val: 1.00E-155ISS
UniRef100_Q9LNU5UniRef Annotation by Michelle Graham. Most informative UniRef hit: T20H2.2 protein n=2 Tax=Arabidopsis thaliana RepID=Q9LNU5_ARATH SoyBaseE_val: 2.00E-17ISS

Expression Patterns of Glyma06g02400
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma06g02400
ParalogEvidenceComments
Glyma04g02360 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma06g02400 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.06g021500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma06g02400
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma06g02400
>Glyma06g02400.1   sequence type=CDS   gene model=Glyma06g02400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAACCGGCAATCCTTGGGATTTTATTCCCCTGTTTCTATTTTATCCTTCCAATAAGATGGAAAGTTGTTTTCTTCTATTGAATTTTTATTCTCTTTGTTTTCATTCTGCTTTGCTGCATCTGATTCATGGGGAAATTCTGGTGGGCTCGCACAGTGAAAGTTTCGTTGTTGAATCAGCAACATGCGTTACATGCCTTAATATAAGTCATACCTGTCATAACTATTTAAGGAAGAGCAACATGGCTACTTGTAAAATCATTGTTATCTGGCTTAAAGGGAAATTCTATGGGGCTCAAACACGGAACTTATCTAGGGCTTCTGTTATAGAGGAAGTAGCGGAGTCTGCAACACAAGTAGTTGGGAGCTCTTATTATAACACCATAAAGAATGCCTTCAATGACACAAAAACTGATATTCAGACCAGAGTTTCTTTTAAGATGTTTGCATTTGAAATTGTGTTCAAAATATGCTGCTTCGAGAGGGGTGTATGGACGCCATTTTTCTATGTCAATGGATTCTTGTTGCCTGATACTGGAGGTGCTGTTGACTACAAGACTTGGAGGAAGGTCATTGACCCATTGTCCAGTTGCATTAGCACTGCATCAGTGAAGGAATCTGAAGAATGTGTCCGCTGA
Predicted protein sequences of Glyma06g02400
>Glyma06g02400.1   sequence type=predicted peptide   gene model=Glyma06g02400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
METGNPWDFIPLFLFYPSNKMESCFLLLNFYSLCFHSALLHLIHGEILVGSHSESFVVESATCVTCLNISHTCHNYLRKSNMATCKIIVIWLKGKFYGAQTRNLSRASVIEEVAESATQVVGSSYYNTIKNAFNDTKTDIQTRVSFKMFAFEIVFKICCFERGVWTPFFYVNGFLLPDTGGAVDYKTWRKVIDPLSSCISTASVKESEECVR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo