Report for Sequence Feature Glyma06g01370
Feature Type: gene_model
Chromosome: Gm06
Start: 854772
stop: 855707
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma06g01370
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G17080 AT
Annotation by Michelle Graham. TAIR10: Arabidopsis protein of unknown function (DUF241) | chr2:7433326-7434117 REVERSE LENGTH=263
SoyBase E_val: 6.00E-43 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PF03087 PFAM
Arabidopsis protein of unknown function
JGI ISS
UniRef100_B0BLI0 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: CM0216.320.nc protein n=1 Tax=Lotus japonicus RepID=B0BLI0_LOTJA
SoyBase E_val: 1.00E-98 ISS
UniRef100_I1K763 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K763_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma06g01370
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma06g01370
Paralog Evidence Comments
Glyma04g01311 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma06g01370 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.06g011600 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma06g01370
Coding sequences of Glyma06g01370
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma06g01370.1 sequence type=CDS gene model=Glyma06g01370 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCAGTTACTGAAACAAGCACAAAAAGCTCTCTTCACACTCGATGCAACAGCTTGCCCTCCACACCTAACCCACTCATATCACAATGTGAGGAGCATATGCAAAGATTGCAGGACTCTGCAGCCATTTCTTCAATATCATCATCATCTTCACTAAGCCACAAACTTAACGGATTGTTGGATTTGCATGACTGCACTTATAAGTTGCTTCAAGTGCCAATTAAACAACAAGCCTTGGCACGAGAGTGCAGTGACAAGTGCGTTGATGACATTCTAGAAGTGTCTCTGAGGCTCTTGGATATCTGCAGTACAGCTAAGGAGTGCCAATTGATATCAAAGGAAAGCATGCAGGAACTTCACTCTGTCATCCAAAGAAGGAAAGGTGATGAAACTGTTTTCACAAAAGTGGGTGGAAAATACTTGGCTTCCAGGAACAAGTTGAAGAAGACAATGAAAGCCATAAAAAGTGAGTTTTACACTTTGTCCATGCTTAGTGTTTTAACCGAAGCAGAAGAGGTCACATTGAGGTCATTAGAATCTTTGTTGTTGTTTATCGGTGACCCCAAGGGACAACCAAAGCAGAGCAGATGGTCAGCAATCTCAAAACTGATGCAGCCTAAAAGAGTGGCTTGTGACTCTCAAGAATCACACACAAATGAATTTGACAAGGTGGATGAAGTTTTGTACTCTTTCCTCAGTCACAAGCCTTCATCTATTGAGTATCTTCTAAGCCGTATTGAAAATTTGGAGATGTGCATTCAGGATCTAGAAATAGGAGTTGAGCACCTCACAAGAAAACTAATTAGGAACAGAAGCAACTCACAAGACATAGGAGTTGAGCACCTAACAAGAAAACTAATTAGGAACAGAGTTTTCCTTCTCAACATCTTCAATCACTAA
Predicted protein sequences of Glyma06g01370
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma06g01370.1 sequence type=predicted peptide gene model=Glyma06g01370 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAVTETSTKSSLHTRCNSLPSTPNPLISQCEEHMQRLQDSAAISSISSSSSLSHKLNGLLDLHDCTYKLLQVPIKQQALARECSDKCVDDILEVSLRLLDICSTAKECQLISKESMQELHSVIQRRKGDETVFTKVGGKYLASRNKLKKTMKAIKSEFYTLSMLSVLTEAEEVTLRSLESLLLFIGDPKGQPKQSRWSAISKLMQPKRVACDSQESHTNEFDKVDEVLYSFLSHKPSSIEYLLSRIENLEMCIQDLEIGVEHLTRKLIRNRSNSQDIGVEHLTRKLIRNRVFLLNIFNH*