SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g38550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g38550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g38550

Feature Type:gene_model
Chromosome:Gm05
Start:41894591
stop:41908653
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G13300AT Annotation by Michelle Graham. TAIR10: ARF GTPase-activating protein | chr5:4255923-4262018 REVERSE LENGTH=827 SoyBaseE_val: 0ISS
GO:0003002GO-bp Annotation by Michelle Graham. GO Biological Process: regionalization SoyBaseN/AISS
GO:0006897GO-bp Annotation by Michelle Graham. GO Biological Process: endocytosis SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009888GO-bp Annotation by Michelle Graham. GO Biological Process: tissue development SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010087GO-bp Annotation by Michelle Graham. GO Biological Process: phloem or xylem histogenesis SoyBaseN/AISS
GO:0010089GO-bp Annotation by Michelle Graham. GO Biological Process: xylem development SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0033043GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of organelle organization SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045595GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation SoyBaseN/AISS
GO:0048439GO-bp Annotation by Michelle Graham. GO Biological Process: flower morphogenesis SoyBaseN/AISS
GO:0048449GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ formation SoyBaseN/AISS
GO:0048519GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process SoyBaseN/AISS
GO:0048589GO-bp Annotation by Michelle Graham. GO Biological Process: developmental growth SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0030140GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network transport vesicle SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005543GO-mf Annotation by Michelle Graham. GO Molecular Function: phospholipid binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0035091GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphatidylinositol binding SoyBaseN/AISS
KOG0521 KOG Putative GTPase activating proteins (GAPs) JGI ISS
PTHR23180Panther CENTAURIN/ARF JGI ISS
PTHR23180:SF22Panther GCN4-COMPLEMENTING PROTEIN JGI ISS
PF00023PFAM Ankyrin repeat JGI ISS
PF00169PFAM PH domain JGI ISS
PF01412PFAM Putative GTPase activating protein for Arf JGI ISS
PF03114PFAM BAR domain JGI ISS
UniRef100_G7LIT7UniRef Annotation by Michelle Graham. Most informative UniRef hit: ADP-ribosylation factor GTPase-activating protein n=1 Tax=Medicago truncatula RepID=G7LIT7_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI00023399C7UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00023399C7 related cluster n=1 Tax=unknown RepID=UPI00023399C7 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g38550 not represented in the dataset

Glyma05g38550 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g200700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g38550.1   sequence type=CDS   gene model=Glyma05g38550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCGTTTCACGAATCTCGATGACACTCCAATGTTCCGCCAACAGCTCCTGTGTTTGGAGGAAAATACTGAATCCTTGCGCGCGAGATGCTGCAAGTTCTACAAAGGATGTCGAAAGTATATGGAAGGTCTTCGAGAGTCATATAATGGGGACATTGCATTTGCAAGTGCCATAGAAAATTTTGGAGGAGGGCACAATGATCCTCATTTTGTTTCTTTGGGAGGACCTGTTATGGCCAAATTTACTATAGCGTTGAGAGAAATCAGTACTTACAAGGAACGGCTCCGGTTTCAAGTAGAGCACATTTTCAATGACCAGTTACTACCCATTGTCGATGTTGACATCCATGAAGTCAAGGAAGCTCGTAAGCGTTTTGATAAAGCTTCCCTTGTATATGACCAGGCACGTGAAAAGTTTATGTCACTGAAAAAAAGCACTAAGATTGACATTGCCACTGTCATAGAAGAGGAGTTGCAGGATGCAAGAGCATCATTTGAGGAAGCCCGTTTCAATCTGGTTGGCACTCTTAATAACATTGAGTTCAAGAAGAGATTTGAGGTTTTAAAGGCTGTAACTGGAATTATGGATGCTCATCTTCGATACTTTCAACAGGGGTATCAGCTATTACATCAGTTGGAACCTTTAATTAGTGAGATTATGGATTATGTAAAACAGTCAAAAGAAAGTTACAATCAGGAGCAGATTTCACTTTATGAAAGAATGCAAGACTACAAAAAACAAGTTTATGAAGAAAGTAGGTTGTCCTTGAATGGTCCTTATGGTTCTCCTAGTAGAGACTCTGCACCTCCGTTTTCTAGGATATCAAATGAAGTGGCAGATGTAGTGATGGAATCCGCTGCAAATGGAAAGGTTCAAATCATTCGACAAGGATATCTTTCTAAACGATCCTCCAATTTGAGAGGTGACTGGAAAAGAAGGTATTTTGTTGTTGACAGTCGAGGAATGTTGTACTACTATCGCAATCCATATGGCAGCAATCAACCATCTCCAAAGAGGAATAGTGGCACTGAAAATGGTTCTGGGCTTCTGAGTCGATGGCTTTCTTCTCATTACCATGGGGGTGTCCATGATGAAAGATCTGTAGCACGTCATACAGTAAGCCTGCTGACATCAACAATCAAGGTTGATGCTGACCAGTCGGATTTAAGATTCTGCTTCAGGATTATTTCGCCATCGAAGAACTATACGTTGCAGGCAGAAAATGCAGTGGATCAGATGGATTGGATGGAAAAGATAAATGGAGTAATTGCCTCCTTATTGAGTGTCCAGACACTGGGAATGCCTCTCTCAGCTGACTCAGAAAACGGCGACTCTTACTCTGATGACAATATTGATAAGTTAGAAAGCTCTCCAGATGATGATCACACTGTGACTGTGAAGTCTGCATCCAAGAATCCCACCCCTAAAAACCAGTTTCGTTCATCTAGAAGTTTGCAGTTGCATAAACACAGTATGAGAATTGAAAAACCAATTGATGTTCTTAGGAGGGTGAGTGGGAATGACAAATGTGCTGATTGTGGTAAACCTGAACCAGAATGGGCATCCTTAAACCTTGGCATCCTTATATGCATTGAGTGTTCTGGTGTTCATCGTAATCTTGGTGTACATATATCAAAAGTAAGATCACTGACACTTGATGTTAAAGTGTGGGATCCCTCTGTTTTAAGTATGCTTAAGTCACTGGGCAATCTTTTTGCAAACTCAGTTTGGGAGGAGCTGCTGTATCCACCGAGTAATTTGCAAACTGTTGACACCCCTGCGAGTTCATCCAAGGAAAATGGAGAGGAGTTCTTTCATGCAAGAAAACCAAAACATGACGATTCTATTTCATTAAAGGAAAGGTTCATTCATGCAAAGTATTCTGAGAAAATATTTATTCCCCGGACAAAGAAATATCACCCTCTCTTTTCACCCGCACAACTGGTGCTGGAAAGCATCTATGCCAATGATAAGAAAGCAGTCTACCAGCATATTATCAAGTCAGATTTTGACATCAATGCCATCGGTTGGCAAGCATCGTCTGATGACTCTTTCAACATGGTTTCTTCAAATAATTTAAACATTGCCTCTCAAAGTGAAATTCAGCCCATTGAGGCCATACAAGATGGTTCTAGCGTGCTTCACCTTGCATGCCTAACTAGTGACATTGGCATGGTGGAGCTGCTCCTACAACATGGGGCAAATATAAATGCTTGTGATTCTAGAGGTCAGACACCACTACATTATTGTATTATTAAAGGGAAGACCGCAGCTGCAAAAGTGCTTATCATGAGGGGAGCCAATACATATGTCGCAGATAAAGAAGGCAAAACTCCTGTTAAGCTTGCATCAGAATCTGGCTGTGGTGATGATGAAATTCTCGCTCTCTTGACAAGCAGATGA

>Glyma05g38550.1   sequence type=predicted peptide   gene model=Glyma05g38550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRFTNLDDTPMFRQQLLCLEENTESLRARCCKFYKGCRKYMEGLRESYNGDIAFASAIENFGGGHNDPHFVSLGGPVMAKFTIALREISTYKERLRFQVEHIFNDQLLPIVDVDIHEVKEARKRFDKASLVYDQAREKFMSLKKSTKIDIATVIEEELQDARASFEEARFNLVGTLNNIEFKKRFEVLKAVTGIMDAHLRYFQQGYQLLHQLEPLISEIMDYVKQSKESYNQEQISLYERMQDYKKQVYEESRLSLNGPYGSPSRDSAPPFSRISNEVADVVMESAANGKVQIIRQGYLSKRSSNLRGDWKRRYFVVDSRGMLYYYRNPYGSNQPSPKRNSGTENGSGLLSRWLSSHYHGGVHDERSVARHTVSLLTSTIKVDADQSDLRFCFRIISPSKNYTLQAENAVDQMDWMEKINGVIASLLSVQTLGMPLSADSENGDSYSDDNIDKLESSPDDDHTVTVKSASKNPTPKNQFRSSRSLQLHKHSMRIEKPIDVLRRVSGNDKCADCGKPEPEWASLNLGILICIECSGVHRNLGVHISKVRSLTLDVKVWDPSVLSMLKSLGNLFANSVWEELLYPPSNLQTVDTPASSSKENGEEFFHARKPKHDDSISLKERFIHAKYSEKIFIPRTKKYHPLFSPAQLVLESIYANDKKAVYQHIIKSDFDINAIGWQASSDDSFNMVSSNNLNIASQSEIQPIEAIQDGSSVLHLACLTSDIGMVELLLQHGANINACDSRGQTPLHYCIIKGKTAAAKVLIMRGANTYVADKEGKTPVKLASESGCGDDEILALLTSR*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo