Glyma05g36370 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g36370

Feature Type:	gene_model
Chromosome:	Gm05
Start:	40211209
stop:	40216490
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g36370

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G39930	AT	Annotation by Michelle Graham. TAIR10: isoamylase 1 \| chr2:16666078-16672183 FORWARD LENGTH=783	SoyBase	E_val: 3.00E-166	ISS
GO:0000023	GO-bp	Annotation by Michelle Graham. GO Biological Process: maltose metabolic process	SoyBase	N/A	ISS
GO:0005975	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0010021	GO-bp	Annotation by Michelle Graham. GO Biological Process: amylopectin biosynthetic process	SoyBase	N/A	ISS
GO:0019252	GO-bp	Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process	SoyBase	N/A	ISS
GO:0043085	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0010368	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast isoamylase complex	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004553	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds	SoyBase	N/A	ISS
GO:0004556	GO-mf	Annotation by Michelle Graham. GO Molecular Function: alpha-amylase activity	SoyBase	N/A	ISS
GO:0019156	GO-mf	Annotation by Michelle Graham. GO Molecular Function: isoamylase activity	SoyBase	N/A	ISS
GO:0043169	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cation binding	SoyBase	N/A	ISS
PTHR10357	Panther	AMYLASE	JGI		ISS
PTHR10357:SF75	Panther	ALPHA-AMLYASE	JGI		ISS
UniRef100_A4PIS8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Isoamylase-type starch-debranching enzyme 1 n=1 Tax=Phaseolus vulgaris RepID=A4PIS8_PHAVU	SoyBase	E_val: 0	ISS
UniRef100_I1K646	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1K646_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma05g36370

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g36370

Paralog	Evidence	Comments
Glyma08g03210	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g36370 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma05g36370

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g36370

Limit To All Plant Sequences

>Glyma05g36370.1   sequence type=CDS   gene model=Glyma05g36370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTCTGGGATGGAGCTAATGCATTTGGTGCTCCAATAGAAGGTGACTTGCTGACAACAGGAGCCCCTCTAAGCAGCCCACCATTGATTGACTTGATCAGTAACGATCCTATACTTTGTGGAGTGAAGCTTATAGCTGAAGCCTGGGATGCTGGTGGCCTCTATCAAGTTGGCACTTTCCCTCACTGGGGTATTTGGTCAGAATGGAATGGGAAGTCTGCAATGTTTGTAGTTACTAGGACAACTAGACAAGTGGTCATATGTACACATGTAACTAAATTTTTCTTGATTCCCTTCATGCAAGCTAAATTTATAGAGACACGGTGCGCCAGTTTATCAAGGGTACAGATGGCTTTGCTGGAGCTTTTGCTGAATGCCTTTGTGGGAGTCCTAATTTATATCAGGGGAGGAGGAAGAAAACCATGGCATAGTATTAACTTTATATGTGCTCATGATGGGTTCACTCTAGCTGATTTGGTGACCTATAACAACAAGAATAATTTGTCAAATGGAGAAGACAATAATGATGGAGAAAATCATAATAATAGCTGGAACTGCGGACAGGAGGGGGAGTTTGTCAGTACCTCAGTGAAGAAATTGAGGAAACCACAAATGCGAAATTTTTTTCTTTCTCTCATGGTTTCCCAGGGAGTTCCAATGATATATATGGGCGATGAATATGGACACACAAAAGGGGGAAATAACAATACCTATTGCCACGATAATTATCTTAATTACTTCCGATGGGACAAAAAGGAAGAATCCTCATCAGACTTCTTCAGATTTTGTCGCCTTATGACTAAGTTCCACCGTTGTCAATGCAACGCTCAGATTAGCATCAGTAGAGAACTTTTAATCCTCAGTTGCTTCATTTACTTTGAGTTCTTTTGTCTTAACGAAAATGTTAGATCCTGTACGTTCTATTATCGAGTAGACTCAGTGAAGGGAGAAATTTACATTGCTTTGAATATGAGTCATTTACCTTTCAGAGTTACCTTGCCGGATTGTCCTGGATACAGATGGGAGCCTCTTGTAGACACCAGCAAGCCTTCACCATATGATTTTCTCACTCCTGACCTCCCTGGAAGAGATATTGCAATACAACAGTATGCTCAGTTTCTGGACGCCAATATGTATCCCATGCTTAGTTATTCTTCCATTATCCTCTTGCGCATTCCAGATGAAAATCCTGCTTCC

Predicted protein sequences of Glyma05g36370

Limit To All Plant Sequences

>Glyma05g36370.1   sequence type=predicted peptide   gene model=Glyma05g36370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
LWDGANAFGAPIEGDLLTTGAPLSSPPLIDLISNDPILCGVKLIAEAWDAGGLYQVGTFPHWGIWSEWNGKSAMFVVTRTTRQVVICTHVTKFFLIPFMQAKFIETRCASLSRVQMALLELLLNAFVGVLIYIRGGGRKPWHSINFICAHDGFTLADLVTYNNKNNLSNGEDNNDGENHNNSWNCGQEGEFVSTSVKKLRKPQMRNFFLSLMVSQGVPMIYMGDEYGHTKGGNNNTYCHDNYLNYFRWDKKEESSSDFFRFCRLMTKFHRCQCNAQISISRELLILSCFIYFEFFCLNENVRSCTFYYRVDSVKGEIYIALNMSHLPFRVTLPDCPGYRWEPLVDTSKPSPYDFLTPDLPGRDIAIQQYAQFLDANMYPMLSYSSIILLRIPDENPAS

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain