SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g35830): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g35830): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g35830

Feature Type:gene_model
Chromosome:Gm05
Start:39802932
stop:39812173
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G26080AT Annotation by Michelle Graham. TAIR10: Protein phosphatase 2C family protein | chr4:13220231-13221828 REVERSE LENGTH=434 SoyBaseE_val: 2.00E-96ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0000303GO-bp Annotation by Michelle Graham. GO Biological Process: response to superoxide SoyBaseN/AISS
GO:0006470GO-bp Annotation by Michelle Graham. GO Biological Process: protein dephosphorylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006914GO-bp Annotation by Michelle Graham. GO Biological Process: autophagy SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0008219GO-bp Annotation by Michelle Graham. GO Biological Process: cell death SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009787GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009788GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0010029GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of seed germination SoyBaseN/AISS
GO:0010119GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0008287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: protein serine/threonine phosphatase complex SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004722GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine phosphatase activity SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0019901GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase binding SoyBaseN/AISS
KOG0698 KOG Serine/threonine protein phosphatase JGI ISS
PTHR13832Panther PROTEIN PHOSPHATASE 2C JGI ISS
PTHR13832:SF115Panther SUBFAMILY NOT NAMED JGI ISS
PF00481PFAM Protein phosphatase 2C JGI ISS
UniRef100_G7L7G3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein phosphatase 2C n=1 Tax=Medicago truncatula RepID=G7L7G3_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1K5Y7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K5Y7_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g35830 not represented in the dataset

Glyma05g35830 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma08g03780 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g227100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g35830.1   sequence type=CDS   gene model=Glyma05g35830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACGAGGACGAGCAACTCGAACGATTCGACTCGGAGTTCGCGTCCACGAGTTCCATTTCCTCCACGCTCAGCACCGACGATTTCCGGAACCTCACCAGCTCCGGTGACATTTCCTCCATCAGCAGCGGCTCCGGCGAGATTCCTCCCGTCTCGGTCCTCGCGCCACCTTTTCTCCACTGCGAGGGGTCCAATGACGGCGAGACGGCGGCGGCAAGGGAGAAGTGCGTGGGAAGGAGTAACAAGGGAGTGAGCTGGGGACACACTTCGGTGATAGGGAGAAGGAAAGAGATGGAGGACGCCGTCGCCGTTATTCCGGGATTCATGTCTCGCACGTGTGATCACATCGGCGGTTGTACGGCTCCCGGTTCTAGATCCTCCGGTGAGATCGCTCCGGTTCATTTCTTCGGCGTTTACGACGGCCACGGTGGCTCTCAGGTGGCTAAGTTTTGTGCGAAGCGGATGCACGATGTTATAGCAGAGGAGTGGGACCGAGAAATGGAAGGTGGCGCTCGATGGCACAGAAGATGGGAAACTGTATTTGCTAACAGTTTTGAGAGGACTGACAATGAAATCCTATCAGACGCAGTTGCGCCTGAAATGGTAGGATCTACTGCCTCTGTGGTGATTCTATCTGGTTGCCAAATTATTACATCCAACTGCGGCGACTCAAGGGTAGTTCTTTACCGCAGGACACAAACTATCCCCTTGACAGTGGATCAGAAGCCGGATAGACAAGATGAACTTTTGAGAATTGAAGGAGGAGGAGGAAGAGTCATAAACTGGAATGGAGCTAGGGTGTTTGGTGTTCTTGCCATGTCCAGGGCCATAGGTGATCGGTACTTGAGACCCTGGATTATTCCGGTGCCAGAGATAACTTTCACAGCAAGAACCGATGAGGATGAGTGCTTAGTTTTGGCTAGTGATGGACTCTGGGATGTAATGACCAATGAAGAGGTTGGAGAAGTAGCACGCCACATTCTTAGAAGGCGCCGCAGATCATTGTCAATGGAGGAAGCATCTCCTGCACAAGTTGTTGCCGACAGCTTGACTGAAATTGCATTAGGTAGAAATAGTAAAGATAACATTTCAATCATAGTTGTTGATCTGAAATCAAAGAGAAAACGTCAGCAAAGGCCTCCTTTAATTTCCTAA

>Glyma05g35830.1   sequence type=predicted peptide   gene model=Glyma05g35830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDEDEQLERFDSEFASTSSISSTLSTDDFRNLTSSGDISSISSGSGEIPPVSVLAPPFLHCEGSNDGETAAAREKCVGRSNKGVSWGHTSVIGRRKEMEDAVAVIPGFMSRTCDHIGGCTAPGSRSSGEIAPVHFFGVYDGHGGSQVAKFCAKRMHDVIAEEWDREMEGGARWHRRWETVFANSFERTDNEILSDAVAPEMVGSTASVVILSGCQIITSNCGDSRVVLYRRTQTIPLTVDQKPDRQDELLRIEGGGGRVINWNGARVFGVLAMSRAIGDRYLRPWIIPVPEITFTARTDEDECLVLASDGLWDVMTNEEVGEVARHILRRRRRSLSMEEASPAQVVADSLTEIALGRNSKDNISIIVVDLKSKRKRQQRPPLIS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo