SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g35040

Feature Type:gene_model
Chromosome:Gm05
Start:39178241
stop:39182014
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g35040
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G21150AT Annotation by Michelle Graham. TAIR10: XAP5 family protein | chr2:9065397-9067921 FORWARD LENGTH=337 SoyBaseE_val: 0ISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010099GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of photomorphogenesis SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0042752GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of circadian rhythm SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG2894 KOG Uncharacterized conserved protein XAP-5 JGI ISS
PTHR12722Panther XAP-5 PROTEIN-RELATED JGI ISS
PF04921PFAM XAP5 protein JGI ISS
UniRef100_G7LAJ6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein XAP5 CIRCADIAN TIMEKEEPER n=2 Tax=Medicago truncatula RepID=G7LAJ6_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1K5R0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K5R0_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g35040
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g35040
ParalogEvidenceComments
Glyma08g04680 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g35040 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g234700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g35040
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g35040
>Glyma05g35040.1   sequence type=CDS   gene model=Glyma05g35040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGGGTATGGGAGACGGGTACGTGGGCACCGCCCAAGACGCGGTGAGGATTCGACGGTTGGAGAAGCAGAGAGAAGCGGAGCGTCGCAAAATCCAAGAGCTCAAAACCAAGTCGACCTCCGCCAAGGGCCAACCCGGTCTCCTCCAATTCGGTTCCAGCACTTCCGAGATTCTTGAGACTGCCTTTAAGAAGGAAACTGTGGGTTTGGTCACTAGAGAGCAGTATGTAGAAAAGAGGGTTAACATTCAGAGCAAAATTGAGGAGGAAGAGAAGGAGAAACTTCAGAAGCAACAGCAAGAAGAGGAGGAGCTTCAATTAGAAAAGCGTAAAAAGAGGAAGATCAGGGGCAACTCTCGATTGTCCTTTGCTGAGGATGTTGACAATGATCCCCAAGACGACGAACCACATCATAGTAAGGATAATCTGGAAGCAAATAGATTACGGTGTGGTAAGCTTGGTAAAGACCCTACTGTTGAAACTAGCTTTCTACCTGACAGTGAGCGAGAGGCTGAGGAGCAAGCTGAGCGTGAAAGGCTGCGGAAACAGTGGCTTCGTGAGCAGGAGCAAATTCGAAATGAGCCTCTTGAAATCACGTACAGCTACTGGGATGGAACTGGCCACAGGCGTGTGATCCAGGTACGCAAGGGTGACAGCATAGGAGAGTTTCTTCGAGCAGTTCAACAGCAACTTGCTCCTGAATTCCGAGAGATTCGAACAACTACAGTAGAAAATTTGTTATACGTGAAAGAAGACCTTATCATTCCTCATCAACATAGCTTCTATGAGCTAATTGTGAACAAAGCTAGAGGCAAAAGTGGACCGCTTTTTCATTTCGATGTGCATGAGGATGTACGAACAATTGCTGATGCCACTATAGAGAAGGATGAGTCTCATGCTGGGAAGGTTGTAGAAAGGCATTGGTATGAAAAGAACAAGCATATATTTCCTGCTTCAAGATGGGAGATATATGATCCAGCGAAGAAATGGGAACGTTATACTATCCACGGGGATTGA
Predicted protein sequences of Glyma05g35040
>Glyma05g35040.1   sequence type=predicted peptide   gene model=Glyma05g35040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGMGDGYVGTAQDAVRIRRLEKQREAERRKIQELKTKSTSAKGQPGLLQFGSSTSEILETAFKKETVGLVTREQYVEKRVNIQSKIEEEEKEKLQKQQQEEEELQLEKRKKRKIRGNSRLSFAEDVDNDPQDDEPHHSKDNLEANRLRCGKLGKDPTVETSFLPDSEREAEEQAERERLRKQWLREQEQIRNEPLEITYSYWDGTGHRRVIQVRKGDSIGEFLRAVQQQLAPEFREIRTTTVENLLYVKEDLIIPHQHSFYELIVNKARGKSGPLFHFDVHEDVRTIADATIEKDESHAGKVVERHWYEKNKHIFPASRWEIYDPAKKWERYTIHGD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo