Glyma05g34760 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g34760

Feature Type:	gene_model
Chromosome:	Gm05
Start:	38987737
stop:	38992239
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g34760

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G73805	AT	Annotation by Michelle Graham. TAIR10: Calmodulin binding protein-like \| chr1:27745761-27749178 REVERSE LENGTH=451	SoyBase	E_val: 2.00E-133	ISS
GO:0000165	GO-bp	Annotation by Michelle Graham. GO Biological Process: MAPK cascade	SoyBase	N/A	ISS
GO:0001666	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hypoxia	SoyBase	N/A	ISS
GO:0002237	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to molecule of bacterial origin	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0009581	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of external stimulus	SoyBase	N/A	ISS
GO:0009595	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus	SoyBase	N/A	ISS
GO:0009617	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to bacterium	SoyBase	N/A	ISS
GO:0009627	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009814	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009863	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010112	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of systemic acquired resistance	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0031347	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of defense response	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0035304	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0043900	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process	SoyBase	N/A	ISS
GO:0045087	GO-bp	Annotation by Michelle Graham. GO Biological Process: innate immune response	SoyBase	N/A	ISS
GO:0045088	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0080142	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005516	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calmodulin binding	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
PF07887	PFAM	Calmodulin binding protein-like	JGI		ISS
UniRef100_I1K5M7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K5M7_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q9C9T2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Calmodulin binding protein-like protein n=2 Tax=Arabidopsis thaliana RepID=Q9C9T2_ARATH	SoyBase	E_val: 1.00E-130	ISS

Expression Patterns of Glyma05g34760

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g34760

Paralog	Evidence	Comments
Glyma08g04920	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g34760 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g237200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g34760

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g34760

Limit To All Plant Sequences

>Glyma05g34760.1   sequence type=CDS   gene model=Glyma05g34760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGCGAAACGGTTTTTTGATGATTCTGATCAAGACAATAATAAGCCACCAGGCGATAAACGGATGAGAACTACACCAAGACCTTCTTTTGCTTCGGTAATAGGAGAAGTGGTGATGGTGAAAAACTTGCAGAACCTTTTCTCAGGCTTGGAGCCCTTGCTTAGAAGAGTGGTGAATGAAGAGGTGGAGCGAGTGATGAGGCATTGTACTGTGCCACGTACAATAAGTAGGTCCCCTTCGTTGAGGATCGAAGCAGCATCATTGGAGAAACCATCGAACTATGAACTCATGTTCAGCAAGAAGCTATTGGTCCCTATATTCACAGGAAGCAGAATAGTGGACATAGATGGGAACCCAATCCAGGTGATTCTGGTTGACAAAAGTGGCGGTGATGGTGAATTAGTAGCGGTTCCCACGAGTGTGCCCCAGCCCATAAAGCTAGAGATAGTGGTGCTTGATGGAGATTTTCCTAACAACAAGGAATCATGGACGACTGAGGAGTTCAACAACAACATAGTGAAGGAGAGAACGGGGAAGAGGCCATTGCTCACAGGAGAATTGAATCTGACCATGAGGGATGGGATTGCACCAATTGAAGAGATTGAGTTCACTGATAACTCTAGTTGGATACGAAGCAGGAAGTTCAGAGTTGCTGTTAGGGTGGCTCCAGGGAGTAATCACACTCTCCCAATTCGTCAAGGAATGACTGAGCCATTTGTTGTTAAGGATCACCGTGGTGAATTGTACAAGAAACATTACCCACCTAAGCTCAATGACGAAGTGTGGCGCCTAGAGAAGATTGGTAAAGACGGAGCTTTCCACAAAAAATTGTCCAAAGAGGGGATAAACAGCGTCCAAGACTTTCTCAAGTTATCCGTTGTTGATGTCCATAGGCTCAGAAAGATTTTGGGCGTTGGGATGTCAGAAAAAATGTGGGAAGTGACAATGAAGCATGCAAAGACTTGCGAGAAGGGCAACAAGTACTACGTGTACCGTGGGCCTAATTTTAGCGTCTTTCTGAATTCCATATGCCAGCTGGTTAGAGCTGATATCAACGGCCAAAGTTTTCCGAGTAGAGAGCGAAGCAACATGACCAGGAGCTATATGGAGAAATTGGTGAGAGAAGCATATGTTAGATGGAATGACTTGGAGGAAATTGATGCGGCTTTCTTAACCCAAGGTGAAACTTTGGAGCAATTTCCAAACAATCATCAAGCATCACTAATAGCATATGATCAGAACGACTATTTTGGTGATAAATCTGCCGAAGTTGGTAACTATGTACCAACCCATAATGCACAAATTGGATGCAGCGAGTGGGCAGTGAATGGAACATTTGGCACAACATCATTTGTGAATGGCATACCTTACAGCTTCTTAGATTCACAATCGGACAGTGACATAAGCCCCTCAGTTGATGGTGCCGCAAGGTGGCCTTAG

Predicted protein sequences of Glyma05g34760

Limit To All Plant Sequences

>Glyma05g34760.1   sequence type=predicted peptide   gene model=Glyma05g34760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAAKRFFDDSDQDNNKPPGDKRMRTTPRPSFASVIGEVVMVKNLQNLFSGLEPLLRRVVNEEVERVMRHCTVPRTISRSPSLRIEAASLEKPSNYELMFSKKLLVPIFTGSRIVDIDGNPIQVILVDKSGGDGELVAVPTSVPQPIKLEIVVLDGDFPNNKESWTTEEFNNNIVKERTGKRPLLTGELNLTMRDGIAPIEEIEFTDNSSWIRSRKFRVAVRVAPGSNHTLPIRQGMTEPFVVKDHRGELYKKHYPPKLNDEVWRLEKIGKDGAFHKKLSKEGINSVQDFLKLSVVDVHRLRKILGVGMSEKMWEVTMKHAKTCEKGNKYYVYRGPNFSVFLNSICQLVRADINGQSFPSRERSNMTRSYMEKLVREAYVRWNDLEEIDAAFLTQGETLEQFPNNHQASLIAYDQNDYFGDKSAEVGNYVPTHNAQIGCSEWAVNGTFGTTSFVNGIPYSFLDSQSDSDISPSVDGAARWP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain