SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g34516

Feature Type:gene_model
Chromosome:Gm05
Start:38822147
stop:38824122
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g34516
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G16110AT Annotation by Michelle Graham. TAIR10: response regulator 2 | chr4:9112979-9115785 FORWARD LENGTH=664 SoyBaseE_val: 1.00E-66ISS
GO:0000160GO-bp Annotation by Michelle Graham. GO Biological Process: phosphorelay signal transduction system SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007623GO-bp Annotation by Michelle Graham. GO Biological Process: circadian rhythm SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009735GO-bp Annotation by Michelle Graham. GO Biological Process: response to cytokinin stimulus SoyBaseN/AISS
GO:0009736GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinin mediated signaling pathway SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0010029GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of seed germination SoyBaseN/AISS
GO:0010119GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement SoyBaseN/AISS
GO:0010150GO-bp Annotation by Michelle Graham. GO Biological Process: leaf senescence SoyBaseN/AISS
GO:0031537GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of anthocyanin metabolic process SoyBaseN/AISS
GO:0048831GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of shoot development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0000156GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphorelay response regulator activity SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PTHR26402Panther RESPONSE REGULATOR OF TWO-COMPONENT SYSTEM JGI ISS
PTHR26402:SF38Panther JGI ISS
PF00072PFAM Response regulator receiver domain JGI ISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
UniRef100_B9HJH2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Type-b response regulator (Fragment) n=1 Tax=Populus trichocarpa RepID=B9HJH2_POPTR SoyBaseE_val: 5.00E-72ISS
UniRef100_I1K5J6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1K5J6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g34516
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g34516 not represented in the dataset
Glyma05g34516 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g34516
ParalogEvidenceComments
Glyma08g05165 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g34516 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma05g34516
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g34516
>Glyma05g34516.1   sequence type=CDS   gene model=Glyma05g34516   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCCAAGTTTCTTCCTTCGAGAAGGTTCAGTATCAATTCCCTGAAAAGATTAGGGTCCTTGTCGTTGATAATAACCCCACAGATCTTGACTTCATCAAGCAAATATGCAATCTATGCAATTATGAGGTTAGCACATGCACTGAATCTACACAAGCATTGAATCTTGTGCTGGAAAGAAAAGATTGTATTGATTTGATACTCATCGAGGTTCATATGCCAACCATGAATGGCTATGAATTCCTTTACCGTGCCAGCAAGGAAATTGATGTTCCAGTTATTGTGATGTCTCTTGATCACAGCAACTATACTGTGACGCGGGCTGTTCAACTTGGGGCTTGTGATTTTTGGGTTAAACCTTTGCGTTATTATCAATTCAAGAATATGTGGACACATGTTTTAAGGAAAAGCCTGAAGGAAAATAACATACAAACAAAAGATTATGTTGGCAGCTTGGAAGATGGTGAGCGAAGCAGAAAACGGGGCAAGGATAATTCTGAATTTGGTTCTTCTTCTGTTGTTAGAGACCAAAGCAATAGCAGTTCCAAGGAAGCTGAAGAATCAAAGCATCGTGTTTCCTCAATGAAGAAGCCCCGTGTAGTATGGATAGCGGAACTGCATAGTAAATTCGTCAATGCTGTCAAAAAACTTGGCCTTCATCAGGCTGTGCCAAAGAGGATTGTTGAAGAGATGAATGTCCCTGGTTTGACTAGAGAGAATGTTGCTAGTCATTTACAGAAATATAGAGATTATTTGAAGAGAAAATCTGAAATGAAAGAGACACAGACACAGGAACACACCGAGATGCAATTGCCTAACATGGTTCCAGGGACTACAGAATCCAGGTCCATAAGGACTCTTGCAGATCCATCTGTATATGGAGCACAGCCCCCATCTAATGCGAATGTGTCAGTTGGTGCAATGCAGCAGTCACTGATCCATCAACAAATGATGATTTCTGGAAATCCAGCTTCTTCCGTCTCTAGGAATATTGATTACGCTCAATCTAGTAATCCTAATCCACTCGGATTTCTTCAAATCCATGATGGAAACACCCTTAATCAGTATACTGCTACAGAAGCTTCCATTTCCCAACAGCTTCAAAACTCAAGTTTGACAAGTGGTGCTGCATCATCAGTGTCTCCCTATGCATATGGTTCCACATCACCCATTCTTTCACTCAGTCTAGGGCTTCCTAACACATCAGCAACTGGTCTTAGTAACCAAAATTCC
Predicted protein sequences of Glyma05g34516
>Glyma05g34516.1   sequence type=predicted peptide   gene model=Glyma05g34516   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQVSSFEKVQYQFPEKIRVLVVDNNPTDLDFIKQICNLCNYEVSTCTESTQALNLVLERKDCIDLILIEVHMPTMNGYEFLYRASKEIDVPVIVMSLDHSNYTVTRAVQLGACDFWVKPLRYYQFKNMWTHVLRKSLKENNIQTKDYVGSLEDGERSRKRGKDNSEFGSSSVVRDQSNSSSKEAEESKHRVSSMKKPRVVWIAELHSKFVNAVKKLGLHQAVPKRIVEEMNVPGLTRENVASHLQKYRDYLKRKSEMKETQTQEHTEMQLPNMVPGTTESRSIRTLADPSVYGAQPPSNANVSVGAMQQSLIHQQMMISGNPASSVSRNIDYAQSSNPNPLGFLQIHDGNTLNQYTATEASISQQLQNSSLTSGAASSVSPYAYGSTSPILSLSLGLPNTSATGLSNQNS






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo