SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g34280): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g34280): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g34280

Feature Type:gene_model
Chromosome:Gm05
Start:38655970
stop:38659416
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G30970AT Annotation by Michelle Graham. TAIR10: zinc finger (C2H2 type) family protein | chr1:11040613-11043593 REVERSE LENGTH=367 SoyBaseE_val: 9.00E-153ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009910GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of flower development SoyBaseN/AISS
GO:0051568GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K4 methylation SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0042803GO-mf Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity SoyBaseN/AISS
GO:0046982GO-mf Annotation by Michelle Graham. GO Molecular Function: protein heterodimerization activity SoyBaseN/AISS
KOG2893 KOG Zn finger protein JGI ISS
PTHR23215Panther ZINC FINGER PROTEIN 207 JGI ISS
UniRef100_G7LCD1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Zinc finger protein n=1 Tax=Medicago truncatula RepID=G7LCD1_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1K5G9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K5G9_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g34280 not represented in the dataset

Glyma05g34280 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma08g05390 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g241800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g34280.1   sequence type=CDS   gene model=Glyma05g34280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGAAGAAGAAGAAGAGAGTTTCCTCGAAGGTGTGGTGTTATTACTGCGATCGCGAATTCGACGACGAGAAGATCTTGGTGCAGCATCAGAAAGCCAAGCACTTCAAGTGCCATGTCTGCCACAAGAAGCTCTCCACCGCCGGCGGCATGGCCATCCACGTCCTCCAGGTTCACAAGGAATCCGTCACTAAGGTGCCCAATGCAAAGCCTGGTAGAGAGAGTACGGATATTGAAATATATGGAATGCAAGGGATTCCACCAGATATCCTGGCTGCTCATTATGGTGAAGAAGAGGATGATGTTCCATCAAAGGCAGCCAAAGTGGATATTCCACCAACTCAGCTTGTAGGTGGAATGATTCCACCTCCTTTGGGTACAGGATATCCTTCGCGACCAGCCTTGCCCACGATGCCACCAGTTTATAATCCAGCTGTACCTGTGCCTCCAAATGCTTGGGTGGTTCCACCTCGACCTCAGCCATGGTTTTCACAGCCTCCAGTTGTTTCAGTTCCTCCTGCTGCCCCATACACACAGCAGCCATTATTCCCTGTGCAGAACGTGAGGCCTCCACTGCCAGCAACTGCTCCTGCCCTCCAAACTCAGATTACTCCTCCTGGATTGCCTACATCTGCACCTGTCCCAGTTTCGCAACCTTTATTTCCTGTTGTTGGAAATAACCATACAACTACTCAAAGTTCTGCATTTTCTGCTCCACCCCTGCCCTCAAGTGTTCCATCAGTTACTCCAGTGATGTCTACAAATGTTCCTGTTGATACACATTTGAGCAGCAACTCTTCAGTAACAAGTAGTTATCAGGCTATAGGGGTTCCAGGTGGAGCAGCTAGTAACTCACATTCTTATGCTTCTGGTCCAAATACTGGTGGTCCTTCAATTGGGCCTCCCCCAGTAATTGCAAACAAAGCTCCTGCTCCTCAGCCTGCCACCAACGAAGTCTACTTGGTTTGGGATGATGAGGCAATGTCCATGGAGGAAAGAAGAATGTCTTTGCCAAAATATCAGGTGCATGATGAAAGTAGCCAGATGAGCTCCATTGATGCAGCCATAGATAAGAGGATACTTGAGAGCAGGCTGGCTGGTCGTATGGCATTTTAG

>Glyma05g34280.1   sequence type=predicted peptide   gene model=Glyma05g34280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKKKKRVSSKVWCYYCDREFDDEKILVQHQKAKHFKCHVCHKKLSTAGGMAIHVLQVHKESVTKVPNAKPGRESTDIEIYGMQGIPPDILAAHYGEEEDDVPSKAAKVDIPPTQLVGGMIPPPLGTGYPSRPALPTMPPVYNPAVPVPPNAWVVPPRPQPWFSQPPVVSVPPAAPYTQQPLFPVQNVRPPLPATAPALQTQITPPGLPTSAPVPVSQPLFPVVGNNHTTTQSSAFSAPPLPSSVPSVTPVMSTNVPVDTHLSSNSSVTSSYQAIGVPGGAASNSHSYASGPNTGGPSIGPPPVIANKAPAPQPATNEVYLVWDDEAMSMEERRMSLPKYQVHDESSQMSSIDAAIDKRILESRLAGRMAF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo