Glyma05g34070 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g34070

Feature Type:	gene_model
Chromosome:	Gm05
Start:	38511154
stop:	38513219
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g34070

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G18130	AT	Annotation by Michelle Graham. TAIR10: receptor for activated C kinase 1C \| chr3:6211109-6212371 REVERSE LENGTH=326	SoyBase	E_val: 0	ISS
GO:0001510	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA methylation	SoyBase	N/A	ISS
GO:0009165	GO-bp	Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009220	GO-bp	Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009845	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed germination	SoyBase	N/A	ISS
GO:0048364	GO-bp	Annotation by Michelle Graham. GO Biological Process: root development	SoyBase	N/A	ISS
GO:0048367	GO-bp	Annotation by Michelle Graham. GO Biological Process: shoot development	SoyBase	N/A	ISS
GO:0071215	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0005730	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleolus	SoyBase	N/A	ISS
GO:0005834	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: heterotrimeric G-protein complex	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
KOG0279	KOG	G protein beta subunit-like protein	JGI		ISS
PTHR19868	Panther	RECEPTOR FOR ACTIVATED PROTEIN KINASE C (RACK1)	JGI		ISS
PF00400	PFAM	WD domain, G-beta repeat	JGI		ISS
UniRef100_I1K5E6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K5E6_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q39836	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Guanine nucleotide-binding protein subunit beta-like protein n=1 Tax=Glycine max RepID=GBLP_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma05g34070

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g34070

Paralog	Evidence	Comments
Glyma08g05610	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g34070 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g243800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g34070

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g34070

Limit To All Plant Sequences

>Glyma05g34070.1   sequence type=CDS   gene model=Glyma05g34070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGAGGGTCTCGTTCTCCGCGGAACCATGCGCGCCCACACCGACGTCGTGACGGCGATTGCCACTCCCATCGACAACTCCGACATGATCGTGACGGCGTCGCGCGACAAATCCATCATTCTCTGGCACCTCACCAAGGAGGACAAGACCTACGGTGTCCCCCGCCGCCGCCTCACCGGACATTCTCACTTCGTCCAGGACGTCGTCCTCTCATCCGACGGTCAGTTCGCCCTCTCCGGCTCCTGGGACGGCGAGCTCCGCCTCTGGGACCTCGCGGCTGGCACCTCTGCCCGCCGCTTCGTTGGCCACACCAAGGACGTGCTCTCCGTGGCGTTCTCCATCGACAACCGTCAGATCGTGTCGGCCTCTCGTGACCGCACGATCAAGCTGTGGAACACCCTGGGTGAGTGCAAGTACACAATCCAAGATGGCGATGCGCATTCGGATTGGGTAAGTTGCGTCCGTTTCAGCCCTAGCACTCTTCAGCCAACCATTGTTTCTGCTTCATGGGACAGGACCGTTAAGGTTTGGAACCTGACCAACTGCAAGCTGAGGAACACCCTTGCTGGACACAATGGGTATGTGAATACTGTTGCTGTTTCCCCTGATGGCTCTCTCTGTGCCAGTGGTGGCAAAGATGGGGTTATTCTTCTGTGGGATTTGGCTGAGGGTAAGCGTCTTTACTCTCTCGATGCTGGCTCAATCATCCATGCACTCTGCTTCAGCCCCAACAGGTACTGGCTCTGCGCCGCCACCGAGCAGAGCATCAAGATCTGGGATTTGGAGAGCAAGAGTATCGTTGAGGATTTGAAGGTTGACCTCAAGACTGAGGCTGATGCCACCTCCGGTGGTGGTAACGCCAACAAGAAGAAGGTTATTTATTGCACAAGTTTGAACTGGAGTGCGGATGGAAGCACTTTGTTTAGTGGCTATACCGATGGTGTGGTCAGAGTTTGGGCTATTGGACGTTATTAG

Predicted protein sequences of Glyma05g34070

Limit To All Plant Sequences

>Glyma05g34070.1   sequence type=predicted peptide   gene model=Glyma05g34070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEGLVLRGTMRAHTDVVTAIATPIDNSDMIVTASRDKSIILWHLTKEDKTYGVPRRRLTGHSHFVQDVVLSSDGQFALSGSWDGELRLWDLAAGTSARRFVGHTKDVLSVAFSIDNRQIVSASRDRTIKLWNTLGECKYTIQDGDAHSDWVSCVRFSPSTLQPTIVSASWDRTVKVWNLTNCKLRNTLAGHNGYVNTVAVSPDGSLCASGGKDGVILLWDLAEGKRLYSLDAGSIIHALCFSPNRYWLCAATEQSIKIWDLESKSIVEDLKVDLKTEADATSGGGNANKKKVIYCTSLNWSADGSTLFSGYTDGVVRVWAIGRY*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain