Report for Sequence Feature Glyma05g33920
Feature Type: gene_model
Chromosome: Gm05
Start: 38426007
stop: 38428252
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma05g33920
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G18170 AT
Annotation by Michelle Graham. TAIR10: FKBP-like peptidyl-prolyl cis-trans isomerase family protein | chr1:6254291-6255507 FORWARD LENGTH=247
SoyBase E_val: 4.00E-91 ISS
GO:0000413 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein peptidyl-prolyl isomerization
SoyBase N/A ISS
GO:0006457 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein folding
SoyBase N/A ISS
GO:0018208 GO-bp
Annotation by Michelle Graham. GO Biological Process: peptidyl-proline modification
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0009535 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane
SoyBase N/A ISS
GO:0003755 GO-mf
Annotation by Michelle Graham. GO Molecular Function: peptidyl-prolyl cis-trans isomerase activity
SoyBase N/A ISS
GO:0005528 GO-mf
Annotation by Michelle Graham. GO Molecular Function: FK506 binding
SoyBase N/A ISS
KOG0552
KOG
FKBP-type peptidyl-prolyl cis-trans isomerase
JGI ISS
PTHR10516 Panther
FK506 BINDING PROTEIN
JGI ISS
PTHR10516:SF122 Panther
IMMUNOPHILIN / FKBP-TYPE PEPTIDYL-PROLYL CIS-TRANS
JGI ISS
PF00254 PFAM
FKBP-type peptidyl-prolyl cis-trans isomerase
JGI ISS
UniRef100_I1K5D1 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Peptidyl-prolyl cis-trans isomerase n=1 Tax=Glycine max RepID=I1K5D1_SOYBN
SoyBase E_val: 0 ISS
UniRef100_I1K5D1 UniRef
Annotation by Michelle Graham. Best UniRef hit: Peptidyl-prolyl cis-trans isomerase n=1 Tax=Glycine max RepID=I1K5D1_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma05g33920
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma05g33920
Paralog Evidence Comments
Glyma08g05730 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma05g33920 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.05g245200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma05g33920
Coding sequences of Glyma05g33920
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma05g33920.1 sequence type=CDS gene model=Glyma05g33920 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCTGCTTTCTTTGGTTCCCCACCAATTTTCTCCCTCCCCCCTACTATTATTAGAACTCATCACATTTCTTCATCATCACAAACTCCACCACCAACACCTTCACCACAATCTCAGCCTCCAACTTCGTCTCCACAGCAGCTAAGAACAACAAATTTGAATGAGGAATCAGTGCAAGTGTCCACTGAAGCTAAGCAACAGAAGCCCATCAAACCAGTCACTTCATCCACTAAGGTTGGATCCACGGATTGGATAGCCACTTCCTTGACCAGAAGGTTTGGGATAGGAGCTGGTCTTGCATGGGTTGGCTTTCTTGCATTTGGTGTCATCTCAGAACAAATCAAGACTCGCCTTGAGCTGTCTCAGCAAGAGGCAAATACAAGGAACGTTGAGAAGGTGGAAGAGGTGGTGCTTCCTAATGGCATAAGGTACTATGAGTTGAAACTTGGTGGTGGCGCTTCACCAAGGCCGGGAGATTTGGTTGTGATTGATATCATGGGAAAAATTGAAAGTAGTGAAGTGTTTGTAGACACATTTGAGGGGGACAAGAAACCATTGGCTCTAGTGATGGGGTCAAGGCCATATAGTAAGGGAGTCTGTGAAGGTATAGAATATGCACTTAAAACTATGAAGGCTGGAGGCAAGAGGAAGGTAATAGTCCCTCCTAAATTGGGGTTTGGAGAGAATGGTGCTGACTTAGGCACTGGTGTGCAAATTCCTCCACTTGCAACACTTGAATACATTCTAGAGGTTGAAAAAGTCTCCATTGCACCCGCTTAA
Predicted protein sequences of Glyma05g33920
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma05g33920.1 sequence type=predicted peptide gene model=Glyma05g33920 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAAFFGSPPIFSLPPTIIRTHHISSSSQTPPPTPSPQSQPPTSSPQQLRTTNLNEESVQVSTEAKQQKPIKPVTSSTKVGSTDWIATSLTRRFGIGAGLAWVGFLAFGVISEQIKTRLELSQQEANTRNVEKVEEVVLPNGIRYYELKLGGGASPRPGDLVVIDIMGKIESSEVFVDTFEGDKKPLALVMGSRPYSKGVCEGIEYALKTMKAGGKRKVIVPPKLGFGENGADLGTGVQIPPLATLEYILEVEKVSIAPA*