SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g33340): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g33340): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g33340

Feature Type:gene_model
Chromosome:Gm05
Start:38035487
stop:38036432
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G07330AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G63060.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | chr5:2316064-2316641 FORWARD LENGTH=165 SoyBaseE_val: 7.00E-33ISS
GO:0006457GO-bp Annotation by Michelle Graham. GO Biological Process: protein folding SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_C6SWY9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SWY9_SOYBN SoyBaseE_val: 2.00E-117ISS
UniRef100_Q2R376UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=2 Tax=Oryza sativa RepID=Q2R376_ORYSJ SoyBaseE_val: 1.00E-22ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g33340 not represented in the dataset

Glyma05g33340 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g199300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g33340.1   sequence type=CDS   gene model=Glyma05g33340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTTTCAGGCCAATGAGTGGTAATTGGTTAGCACTGTTAAGAAACAGTTATGGAGGTAAAGCCGCGTACGCAACCTCAACAGCACCAAAGATGAAAGCGTATGCAGCTGCGGCTGATTACGGACACAAGCAACAACATGGGAAGTCGGCCAAACGGGACTTTGTGGCAATTTACGTGGCGATTGGGATGATAGCTCTGTCCACAGGGCTGGGTCTCCACACTGCGTGGCAGCAACTGAGGAATTCCCCGACGGTGAGCGTGAAGAAGCAGAGGAGGGAGACCCTCCCCGAAGTGGTGGAACCCGACCACGTGGCGGAGGAGGCTGAGAAATTCATGAAGAAATCCTTCTTCAGGAAGGTGGCGCACGTGCAAGAGCGTAGCTACCCTGATCACCACCAAATCCTTAGTCCCATTCACGGAGATGCCTATACTTATACCCCTCGTGTCGAGACCCTCAAGTCCGTTGGGGTCGATCCCTCGCACGTGTGA

>Glyma05g33340.1   sequence type=predicted peptide   gene model=Glyma05g33340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVFRPMSGNWLALLRNSYGGKAAYATSTAPKMKAYAAAADYGHKQQHGKSAKRDFVAIYVAIGMIALSTGLGLHTAWQQLRNSPTVSVKKQRRETLPEVVEPDHVAEEAEKFMKKSFFRKVAHVQERSYPDHHQILSPIHGDAYTYTPRVETLKSVGVDPSHV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo