SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g33231): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g33231): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g33231

Feature Type:gene_model
Chromosome:Gm05
Start:37953235
stop:37954927
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g33231
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G51330AT Annotation by Michelle Graham. TAIR10: SWITCH1 | chr5:20858752-20861680 REVERSE LENGTH=639 SoyBaseE_val: 4.00E-16ISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0007065GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis sister chromatid cohesion SoyBaseN/AISS
GO:0007066GO-bp Annotation by Michelle Graham. GO Biological Process: female meiosis sister chromatid cohesion SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0004629GO-mf Annotation by Michelle Graham. GO Molecular Function: phospholipase C activity SoyBaseN/AISS
UniRef100_I1KP06UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KP06_SOYBN SoyBaseE_val: 3.00E-85ISS
UniRef100_Q9FGN8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein DYAD n=1 Tax=Arabidopsis thaliana RepID=DYAD_ARATH SoyBaseE_val: 2.00E-13ISS

Expression Patterns of Glyma05g33231
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g33231 not represented in the dataset
Glyma05g33231 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g33231
ParalogEvidenceComments
Glyma08g00830 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g33231 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g198200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g33231
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g33231
>Glyma05g33231.1   sequence type=CDS   gene model=Glyma05g33231   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAATCATGGAGTATTGGTTGGAGAGTGCTAATTTGGATGAGATTCACCAGGAGACTGGGGTGCAAGACCCTTACTGGATACCACCATCGACATTTGGGGCTGGCGGTGTTCCTACTGAGAATATTGATTATATTGGTGAACTGAAAATTCTTAAAATAGAAATGGCCCAGATGAAGAAAGACATGCAAGAGCTCATTTCCAAGAAGCAAGAAAAAAGTGAAATGTGTTTGATGGAGCTTTACATATTGACAGGCATGCATGAAAACATGTTGATTTGGAAAACTAAAGTTGAGCAACAGCTAATGGAAATAACCAATAAATTGAGTGATGTGCGGAAATTGAGAGAAGACACCACTTTAAGTTATCCTCCGGTAAGTTGGGAGGATTGGCTAGAAAGCACCAACATAGACAATATTCAGGGAAAAGAACTTGCGCCTTGGTTTGGGAATCCTGAGCTGCTTAATGTTCCACAAGAGGTTGTACTTCAAGATCTGAACTCATCCCTACCAACTCAGCTGCACAGTGTAGAACTGACTAACATGAATAGCAATTTGCCGGAGTTGGTGCCTAATATAAAGGAAATCAACCTAATGTGA
Predicted protein sequences of Glyma05g33231
>Glyma05g33231.1   sequence type=predicted peptide   gene model=Glyma05g33231   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGIMEYWLESANLDEIHQETGVQDPYWIPPSTFGAGGVPTENIDYIGELKILKIEMAQMKKDMQELISKKQEKSEMCLMELYILTGMHENMLIWKTKVEQQLMEITNKLSDVRKLREDTTLSYPPVSWEDWLESTNIDNIQGKELAPWFGNPELLNVPQEVVLQDLNSSLPTQLHSVELTNMNSNLPELVPNIKEINLM*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo