SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g33010): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g33010): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g33010

Feature Type:gene_model
Chromosome:Gm05
Start:37781531
stop:37786904
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G38290AT Annotation by Michelle Graham. TAIR10: ammonium transporter 2 | chr2:16039672-16042291 REVERSE LENGTH=475 SoyBaseE_val: 0ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0002237GO-bp Annotation by Michelle Graham. GO Biological Process: response to molecule of bacterial origin SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006820GO-bp Annotation by Michelle Graham. GO Biological Process: anion transport SoyBaseN/AISS
GO:0006862GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0006995GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to nitrogen starvation SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009581GO-bp Annotation by Michelle Graham. GO Biological Process: detection of external stimulus SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009624GO-bp Annotation by Michelle Graham. GO Biological Process: response to nematode SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009749GO-bp Annotation by Michelle Graham. GO Biological Process: response to glucose stimulus SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015695GO-bp Annotation by Michelle Graham. GO Biological Process: organic cation transport SoyBaseN/AISS
GO:0015696GO-bp Annotation by Michelle Graham. GO Biological Process: ammonium transport SoyBaseN/AISS
GO:0015802GO-bp Annotation by Michelle Graham. GO Biological Process: basic amino acid transport SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031347GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of defense response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0043269GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of ion transport SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0008519GO-mf Annotation by Michelle Graham. GO Molecular Function: ammonium transmembrane transporter activity SoyBaseN/AISS
GO:0015398GO-mf Annotation by Michelle Graham. GO Molecular Function: high affinity secondary active ammonium transmembrane transporter activity SoyBaseN/AISS
KOG0682 KOG Ammonia permease JGI ISS
PTHR11730Panther AMMONIUM TRANSPORTER JGI ISS
PTHR11730:SF1Panther AMMONIUM TRANSPORTER JGI ISS
PF00909PFAM Ammonium Transporter Family JGI ISS
UniRef100_G7LFR8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ammonium transporter 3 member n=1 Tax=Medicago truncatula RepID=G7LFR8_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1K536UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1K536_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g33010 not represented in the dataset

Glyma05g33010 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g196500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g33010.1   sequence type=CDS   gene model=Glyma05g33010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACTCCTCCGGTGAATTCGTTGCCAATAGCATACCAAGCATGGACAAGCCTGGGAGTCCCAGATTGGTTGAACAAAGGAGACAACGCATGGCAAATGGTGTCAGCCACCTTGGTTGGGATTCAAAGCATGCCGGGCCTCGTCATCCTCTACGGAAGCATCGTCAAAAAGAAATGGGCCGTCAACTCTGCCTTCATGGCCCTCTACGCTTTTGCGGCGGTTATCATCTGTTGGGTGGCGTGGGCCTACAAGATGTCGTTTGGGGAGGAGCTGCTGCCGTTTTGGGGCAAAGCCGGGCCCGCGTTGGGCCAGAGGTTTCTGATAAAGCAGGCGGGCCTGCCCGCCACGCCGCATTATTTTAGAAACGGTGGTGGTTTGGAGACGGCGGAGATAACGCCGTTTTATCCGATGGGTACTATGGTATGGTTTCAGTGTGTTTTTGCGGCTATTGCGGTTGTTATATTGGCTGGGTCGGTGCTGGCTAGGATGAACTTCAAGGCGTGGATGATGTTTGTGCCGCTTTGGCTTACTTTCTCTTACACCATTGGGGCGTTTAGCTTGTGGGGTGGAGGGTTCTTGTTCCACTGGGGCGTTATGGACTACTCTGGTGGTTATGTTATTCATCTCTCTTCCGGGATTGCTGGCTTCACTGCTGCTTATTGGGTGGGGCCAAGATCGAAGAAGGACAGAGAGAGATTCCCGCCAAACAATGTGTTGCTAACGTTGGCGGGGGCAGGGCTACTATGGATGGGATGGGCAGGTTTCAACGGCGGAGATCCGTACGCGGCAAACACGGACTCGTCGATGGCGGTGCTTAACACCAACATTTGCGCCGCCACCAGCCTCCTCGTATGGACGTGGTTGGACGTTATTTTCTTCAAGAAACCCTCAGTTATTGGAGCCGTTCAGGGCATGATAACTGGCCTTGTTTGCATCACTCCCGGAGCTGGTCTGGTTCAAGGATGGGCTGCCATAGTGATGGGAGTTCTTTCAGGCAGTGTCCCATGGTTCAGCATGATGGTATTAGGGAAAAAGCTGAAATTGTTTCAAATGGTTGATGACACCCTTGCTGTGTTCCACACTCATGCTGTGGCTGGCCTTCTTGGAGGCATACTCACTGGCCTATTTGCCGAACCTCGTCTGTGTGCACTCTTTCTACCTGTCACCAACTCCAAAGGAGGAGTCTATGGAGGCCCTGGTGGAGTCCAAATCCTTAAACAAATCGTGGGAGCTTTGTTCATCATTGGGTGGAACCTTGTGGTCACTTCAATTATTTGTGTGGTTATTAGTTTCATAGTTCCACTTAGAATGACAGAGGAAGAGCTTCTCATTGGAGATGATGCGGTTCATGGGGAAGAGGCTTATGCTCTGTGGGGTGATGGAGAGAAACTTAGCATCTACAAAGATGATACCACTCACCATGGAGTTGTGTCTAGTGGTGCCACTCAAGTGGTCTAG

>Glyma05g33010.1   sequence type=predicted peptide   gene model=Glyma05g33010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATPPVNSLPIAYQAWTSLGVPDWLNKGDNAWQMVSATLVGIQSMPGLVILYGSIVKKKWAVNSAFMALYAFAAVIICWVAWAYKMSFGEELLPFWGKAGPALGQRFLIKQAGLPATPHYFRNGGGLETAEITPFYPMGTMVWFQCVFAAIAVVILAGSVLARMNFKAWMMFVPLWLTFSYTIGAFSLWGGGFLFHWGVMDYSGGYVIHLSSGIAGFTAAYWVGPRSKKDRERFPPNNVLLTLAGAGLLWMGWAGFNGGDPYAANTDSSMAVLNTNICAATSLLVWTWLDVIFFKKPSVIGAVQGMITGLVCITPGAGLVQGWAAIVMGVLSGSVPWFSMMVLGKKLKLFQMVDDTLAVFHTHAVAGLLGGILTGLFAEPRLCALFLPVTNSKGGVYGGPGGVQILKQIVGALFIIGWNLVVTSIICVVISFIVPLRMTEEELLIGDDAVHGEEAYALWGDGEKLSIYKDDTTHHGVVSSGATQVV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo