Glyma05g32440 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g32440): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g32440): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g32440

Feature Type:	gene_model
Chromosome:	Gm05
Start:	37368000
stop:	37369143
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g32440

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G64620	AT	Annotation by Michelle Graham. TAIR10: cell wall / vacuolar inhibitor of fructosidase 2 \| chr5:25831875-25832417 FORWARD LENGTH=180	SoyBase	E_val: 5.00E-35	ISS
GO:0043086	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of catalytic activity	SoyBase	N/A	ISS
GO:0080167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to karrikin	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0004857	GO-mf	Annotation by Michelle Graham. GO Molecular Function: enzyme inhibitor activity	SoyBase	N/A	ISS
GO:0030599	GO-mf	Annotation by Michelle Graham. GO Molecular Function: pectinesterase activity	SoyBase	N/A	ISS
GO:0046910	GO-mf	Annotation by Michelle Graham. GO Molecular Function: pectinesterase inhibitor activity	SoyBase	N/A	ISS
PF04043	PFAM	Plant invertase/pectin methylesterase inhibitor	JGI		ISS
UniRef100_B9RU29	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Pectinesterase inhibitor, putative n=1 Tax=Ricinus communis RepID=B9RU29_RICCO	SoyBase	E_val: 5.00E-39	ISS
UniRef100_I1K4Y4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K4Y4_SOYBN	SoyBase	E_val: 2.00E-83	ISS

Expression Patterns of Glyma05g32440

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g32440 not represented in the dataset	Glyma05g32440 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g32440

Paralog	Evidence	Comments
Glyma08g16600	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g32440 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma05g32440

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g32440

Limit To All Plant Sequences

>Glyma05g32440.2   sequence type=CDS   gene model=Glyma05g32440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGTGGTCATGGTTGGGATTGGAATGGCCAATGGCACCTCCACTTCTCTCTATTTGTCTTCTCAGTTGCTTGGCACTGCCAACAAGGATTCCACCTTCAAAAGGGTGCTGAAGGAGTGTGTAGAAAAGTACAAGTATGCCAGTGATGCCCTCCAAGCTTCTGCACATGATTTGGCTAATGAGGCATGTGACTATGCTTCCATGCACATCACTGCAGCCTCTGATTACCCCAATGTTTGTCACAACTTGTTCAAACTCTACCCGGGTTTGGTTTATCCTACTGAGCTTGCTCCCAGAGAGGATGGTTTGAAGTGTTTATGTGATGTTGCTTTGAGGATTGTCGAGAATCTTAATTGGTAG

Predicted protein sequences of Glyma05g32440

Limit To All Plant Sequences

>Glyma05g32440.2   sequence type=predicted peptide   gene model=Glyma05g32440   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVVMVGIGMANGTSTSLYLSSQLLGTANKDSTFKRVLKECVEKYKYASDALQASAHDLANEACDYASMHITAASDYPNVCHNLFKLYPGLVYPTELAPREDGLKCLCDVALRIVENLNW*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain