SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g30890

Feature Type:gene_model
Chromosome:Gm05
Start:36121278
stop:36122765
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g30890
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G65340AT Annotation by Michelle Graham. TAIR10: Protein of unknown function, DUF617 | chr5:26113684-26114445 REVERSE LENGTH=253 SoyBaseE_val: 2.00E-78ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF04759PFAM Protein of unknown function, DUF617 JGI ISS
UniRef100_G7JAA0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Plant-specific domain TIGR01570 family protein n=1 Tax=Medicago truncatula RepID=G7JAA0_MEDTR SoyBaseE_val: 4.00E-37ISS
UniRef100_I1K4G3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K4G3_SOYBN SoyBaseE_val: 1.00E-171ISS

Expression Patterns of Glyma05g30890
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g30890
ParalogEvidenceComments
Glyma08g14090 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g30890 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g175200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g30890
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g30890
>Glyma05g30890.1   sequence type=CDS   gene model=Glyma05g30890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAGTGGCGTGACTACAGTGGACTGCGAGAAACAAGTTAGATCATGGAGGCTGATACGTTCTCTCATGCAACTATTAATCCCCACATGTAACTGCGCCACCATTATAGAAGACGGCCAAGATGTAACAACAACAACAAACGAGACCCTCCGAAACACAAGCAAATATACTTATTCACCATCATCGTCACTGATGAGCTCCACCACCAATATCACAGGCACGATCTTCGGATACCGCAGAGGAAAAGTGAGCTTCTGCATTCAGGCAAACGCCAACTCCACCAACCCAATTCTCCTCCTAGAGTTGGCAGTTCCAACAACCATCTTGGCCAAGGAAATGAGAGGAGGAACCCTAAGAATCGCCCTAGAGAGCGGCAACGACGACGATGACGGCGACGGCCAAGTAGACACACTTTTGTCCACGCCTTTGTGGACTATGTACTGCAATGGGAGGAAGGTGGGGTATGCCGTTAAGCGCAGGCCCTCCAACACTGATTTCGAAGCGCTGAGGTTGATGCGTTCGGTGGTTGTTGGAACCGGGGTTATGAAGTGCAAGGAGTTAGTGAACAAAGAAGATGATCAACTTATGTACCTTAGAGCTAGCTTTCAGAGGGTTCGTGGCTCAGACAACTGTGAATCTTTCCACTTGATTGATCCAGAGGGAGACATTGATCAGGAACTCAGTGTTTTCTTTTTTAGGATTGATTTTTCACCGTTCATAGTCAAATTTGAAGATAACTGA
Predicted protein sequences of Glyma05g30890
>Glyma05g30890.1   sequence type=predicted peptide   gene model=Glyma05g30890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASGVTTVDCEKQVRSWRLIRSLMQLLIPTCNCATIIEDGQDVTTTTNETLRNTSKYTYSPSSSLMSSTTNITGTIFGYRRGKVSFCIQANANSTNPILLLELAVPTTILAKEMRGGTLRIALESGNDDDDGDGQVDTLLSTPLWTMYCNGRKVGYAVKRRPSNTDFEALRLMRSVVVGTGVMKCKELVNKEDDQLMYLRASFQRVRGSDNCESFHLIDPEGDIDQELSVFFFRIDFSPFIVKFEDN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo