Glyma05g30650 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g30650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g30650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g30650

Feature Type:	gene_model
Chromosome:	Gm05
Start:	35977891
stop:	35982127
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g30650

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G72550	AT	Annotation by Michelle Graham. TAIR10: tRNA synthetase beta subunit family protein \| chr1:27319947-27323908 REVERSE LENGTH=598	SoyBase	E_val: 4.00E-108	ISS
GO:0006432	GO-bp	Annotation by Michelle Graham. GO Biological Process: phenylalanyl-tRNA aminoacylation	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0009328	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: phenylalanine-tRNA ligase complex	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0000287	GO-mf	Annotation by Michelle Graham. GO Molecular Function: magnesium ion binding	SoyBase	N/A	ISS
GO:0003723	GO-mf	Annotation by Michelle Graham. GO Molecular Function: RNA binding	SoyBase	N/A	ISS
GO:0004826	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phenylalanine-tRNA ligase activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
PTHR10947	Panther	PHENYLALANYL-TRNA SYNTHETASE BETA CHAIN	JGI		ISS
PF03484	PFAM	tRNA synthetase B5 domain	JGI		ISS
UniRef100_G7KG03	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Phenylalanyl-tRNA synthetase beta chain n=1 Tax=Medicago truncatula RepID=G7KG03_MEDTR	SoyBase	E_val: 4.00E-141	ISS
UniRef100_I1K4D8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1K4D8_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma05g30650

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g30650 not represented in the dataset	Glyma05g30650 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma05g30650 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g172900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g30650

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g30650

Limit To All Plant Sequences

>Glyma05g30650.1   sequence type=CDS   gene model=Glyma05g30650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTTGTCATTGAACCAGTTGAAGTGATTTCTTCTGATGGCAAGTCAAACATATACCCTGATTTATCTGTCTACAATATGGAAGTTTCTCTATCTTACATTAATGGATTGATTGGGGTATCATTGGAGGTGGAAGAGGTCACTAAGTACTTAAATCGGATGCAATTGCATGCCAAGCAGTGTGCATCTCATAATAAGCAGTGTAACATTGTGGTATCTGTACCTTCTTCTAGAAGTGATGTTCTTCACCCATGTGATGTTATGGAGGATGTGGCAATTGCTTATGGATTCAATGCTATTAAGGATAAAGTAGTAGTAGATAATAAGGGCTCAAAGAGGTTGGCTGCTTCCTTGACTCTACTTCCTCTGAATGAGCTCAGTGATCTTATCAGAAAAGAGGTTGCTTTAATTGGTTTCACAGAGGTCTTGACATTTATACTCTGCTCTAAAAAGGAAAACTTTGCCATGCTTAACCGCAAAGATGATAAATCTAAAGCAGTTATCATTGGAAACCGTCTTCAGACTTTGAGCATGCATCTGATAGGAGTGGTGATGCATCCAGGCTGCCATCTAGAAATCAATTTGACAAAGCTTACTTATCATCTTTTCTCATTACATCAGACGGCTGTGCGGACTAGTCTTATGCCTGGCATTTTGAAAATTGTTGCTCACAACAAGGATCATCCAAAGCCCATAAAGGTTATCTATGGCAGGTGGAGGAATATCACAGAAATTCCGCCATATAAACATTTCATTGTGGCCTATTGTGCCACTCTAGCGGGCCTCTCTTCCCAAATTGCCTATGGCAGAGGTCAAAAAACGTCATGTGATATAGCAGTTTTGGATGAACAAAGAGATGTTGGTGCAAAAAATCTTCGCCAACTTGCTGCTCTGTACTGTGGTGCTAATGCTGGATTTGAGATAATTCATGGCTTGGTGGACAGAGTAATGGAAAAGAATGGGGTTCCCTTTGTTTCACCTGGTGATAAATCGGGTTATTATATTGAGCGGTCAGATTTTCTTGCTGGTAGACAATCTAGAATCATTTACAAAGGAAAGCATATTGGCACTTTTGGCATTGTTCATCCTGAGGTATTAAACAACTTTGACATTCCTGATCCCTGA

Predicted protein sequences of Glyma05g30650

Limit To All Plant Sequences

>Glyma05g30650.1   sequence type=predicted peptide   gene model=Glyma05g30650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
FVIEPVEVISSDGKSNIYPDLSVYNMEVSLSYINGLIGVSLEVEEVTKYLNRMQLHAKQCASHNKQCNIVVSVPSSRSDVLHPCDVMEDVAIAYGFNAIKDKVVVDNKGSKRLAASLTLLPLNELSDLIRKEVALIGFTEVLTFILCSKKENFAMLNRKDDKSKAVIIGNRLQTLSMHLIGVVMHPGCHLEINLTKLTYHLFSLHQTAVRTSLMPGILKIVAHNKDHPKPIKVIYGRWRNITEIPPYKHFIVAYCATLAGLSSQIAYGRGQKTSCDIAVLDEQRDVGAKNLRQLAALYCGANAGFEIIHGLVDRVMEKNGVPFVSPGDKSGYYIERSDFLAGRQSRIIYKGKHIGTFGIVHPEVLNNFDIPDP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain