SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g30000

Feature Type:gene_model
Chromosome:Gm05
Start:35421769
stop:35428492
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g30000
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G34710AT Annotation by Michelle Graham. TAIR10: Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein | chr2:14639548-14643993 REVERSE LENGTH=852 SoyBaseE_val: 0ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009880GO-bp Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0009955GO-bp Annotation by Michelle Graham. GO Biological Process: adaxial/abaxial pattern specification SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010072GO-bp Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification SoyBaseN/AISS
GO:0010073GO-bp Annotation by Michelle Graham. GO Biological Process: meristem maintenance SoyBaseN/AISS
GO:0010075GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010431GO-bp Annotation by Michelle Graham. GO Biological Process: seed maturation SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0045595GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell differentiation SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048589GO-bp Annotation by Michelle Graham. GO Biological Process: developmental growth SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0080060GO-bp Annotation by Michelle Graham. GO Biological Process: integument development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
KOG0483 KOG Transcription factor HEX, contains HOX and HALZ domains JGI ISS
PTHR24326Panther FAMILY NOT NAMED JGI ISS
PTHR24326:SF218Panther JGI ISS
PF00046PFAM Homeobox domain JGI ISS
PF01852PFAM START domain JGI ISS
PF08670PFAM MEKHLA domain JGI ISS
UniRef100_I1K476UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K476_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q5D1M3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Class III HD-Zip protein 4 n=1 Tax=Populus trichocarpa RepID=Q5D1M3_POPTR SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g30000
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g30000
ParalogEvidenceComments
Glyma08g13110 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g30000 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g166400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g30000
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g30000
>Glyma05g30000.1   sequence type=CDS   gene model=Glyma05g30000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCACTTTGTATGCAGAGTCAGCAGAGAGATTCAGCATCAAACAAGCTGCTCATGGATTGTGGCAAGTATGTGAGGTACACACCTGAACAGGTGGAGGCTTTGGAGAGGGTGTATGTTGAATGTCCAAAGCCTAGTTCTTCCAGAAGGCAACAAATCATTAGGGAGTGTCCACTCCTTGCTAACATTGAAACAAAGCAGATCAAAGTGTGGTTCCAGAATCGCAGATGTCGTGAAAAGCAGCGGAAGGAAGCCTCTCGTCTGCAGACAGTGAATAGAAAGCTGTCTTCAATGAACAAGTTGTTAATGGAAGAGAACGACCGACTGCAGAAGCAGGTCTCACAGTTGGTTTATGATAATGGATTCATGAAACAACAAATACATACTGCATCTGCTACTACTACTACTACTACTGACAATAGCTGTGAGTCTGTGGTAGTGAGTGGTCAACACCAACCGCAAAACCCCAAAACTCAGCATCCCCAGTGGGATGCCAACAACCCAGCTGGTCTTCTTGCTATTGCTCAGGAGACCCTAGTGGAGTTCCTTTCCAAAGCTACTGGAACTGCTGTCAACTGGGTCCAGATGATTGGGATGAAGCCTGGTCCGGATTCTATTGGAATTGTTGCTGTTTCCCGCAACTGTAGTGGCGTAGCGGCAAGAGCCTGTGGCCTTGTGAGCCTAGAGCCCACAAAGGTTGCCGAGATTCTCAAAGATCGTCCATCATGGTATCGTGACTGTCGATGCCTCAATGTATTGAGTGTAGTCTCCGCAGGGAATGGGGGCACAATAGAGCTTATGTACATGCAGACATATGCACCAACAACATTGGCAGCTGCAAGAGACTTCTGGACTCTGAGATACTCTACTAGTTTGGAAGATGGAAGTCTTGTGATTTGTGAGAGGTCCTTGACTTCTTCAACTGGTGGCCCCACAGGGCCAGCTGCTTCAAACTTCATACGAGCTGAAATGCTTCCCAGTGGCTATCTAATTAGATCCTGTGAGGGTGGTGGATCTATCATTCACATTGTTGATCATGTTGATTTAGATGTTTGGAGTGTTCCTGAAGTACTTAGACCCCTCTATGAATCACCAAAATTCTTGGCTCAGAAATTGACTACTGCTGCATTGCGACATGCAAGACAAATTGCACAGGAATCAAGTGGAGATGTTCATTATGGTGGGGGTCGTCAACCTGCTGTCTTGAGGACATTTAGTCAAAGGCTTTGCAAAGGGTTCAATGATGCTGTCAACGGGTTTGTGGATGATGGTTGGTCACTGATGGGTAATGATGGGGTGGAAGATGTGACCATAGCCATAAACTCGTCTCCCAACAAGTTTTTCGGTTCCCATTACAATACATCAATGCTTCCAGCATTTGGAGGTGGGGTCATGTGTGCCAAGGCATCAATGCTGCTACAGAATGTTCCTCCTGCTTTGCTTGTTCGTTTTCTGAGGGAGCATCGTTCAGAGTGGGCTAATTATGAAGTTGATGCATACTCTTCTGCATGTCTCAAAGCTAGTCCTTATGCAGTTCCTTGTGCAAGACCTAGTGGTTTCCCAAGCAGCCATGTCATTATACCACTTGCTCATACTATTGAGCATGAGGAGTTCTTGGAGGTAGTTCGTATTGAGGGTAATGCATTTCCCCCTGATGATGTAGCTTGGGCATGTGATATGTATCTAATGCAGCTGTGCAGTGGAATTGATGAAAATGCAATTGGAGCGTGTGCACAGCTTGTGTTTGCACCTATTGATGAATCATTTGCAGATGATGCTCTCTTACTGCCTTCTGGTTTCCGTATCATACCATTGGATCCTAAAACAGATGGTTTGGCTTCAACTAGGACATTGGACTTAGCATCAACACTGGAAACAGGATCTGGTAATGCCCGCTCAGCTGGTGAAAGTGACTCGAATAACTACAACCTTAGGTCGGTCCTCACAATTGCATTCCAATTTACCTTTGAGAACCATTTGCGGGACAATGTGGCTGTTATGGCTCGCCAGTATGTGCGTAATGTTGTGCGATCTGTTCAGAGGGTTGCCATGGCAATTGCTCCCTCTAGGCTCAGTACACAGTTGGGGCCAAAGTCATTTCCTGGTCCACCAGAGGCTCTTACCTTAGCAAGATGGATCTGCAGAAGCTACAGGCTCCACACCTGCACAGAGCTTTTCAGCGTTGAGTCCACATCTGGTGATGCAATCTTGAAACAACTTTGGCACCATCCAGATGCAATATTGTGCTGTTCTGTAAAAACAGATGCATCTCCGGTGTTCACCTTTGCAAACCAAGCTGGACTTGACATGCTTGAAACCACTCTTGTTGCTCTTCAAGACATAATGCTGGATAAAGTTCTTGATGAAGCTGGCAGGAAGGTTCTCTGCATTGAGTTCTCCAAGATAATGCAACAGGGATTTGCATATCTGCCAGCAGGAATATGTGTATCAAGTATGAATCGACCAGTGTCTTATGAGCAGGCCATTGCATGGAAAGTTCTCGATGATGATGATTCCAATCACTGCCTTGCCTTCGTATTCATGAACTGGTCTTTTGTCTGA
Predicted protein sequences of Glyma05g30000
>Glyma05g30000.1   sequence type=predicted peptide   gene model=Glyma05g30000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALCMQSQQRDSASNKLLMDCGKYVRYTPEQVEALERVYVECPKPSSSRRQQIIRECPLLANIETKQIKVWFQNRRCREKQRKEASRLQTVNRKLSSMNKLLMEENDRLQKQVSQLVYDNGFMKQQIHTASATTTTTTDNSCESVVVSGQHQPQNPKTQHPQWDANNPAGLLAIAQETLVEFLSKATGTAVNWVQMIGMKPGPDSIGIVAVSRNCSGVAARACGLVSLEPTKVAEILKDRPSWYRDCRCLNVLSVVSAGNGGTIELMYMQTYAPTTLAAARDFWTLRYSTSLEDGSLVICERSLTSSTGGPTGPAASNFIRAEMLPSGYLIRSCEGGGSIIHIVDHVDLDVWSVPEVLRPLYESPKFLAQKLTTAALRHARQIAQESSGDVHYGGGRQPAVLRTFSQRLCKGFNDAVNGFVDDGWSLMGNDGVEDVTIAINSSPNKFFGSHYNTSMLPAFGGGVMCAKASMLLQNVPPALLVRFLREHRSEWANYEVDAYSSACLKASPYAVPCARPSGFPSSHVIIPLAHTIEHEEFLEVVRIEGNAFPPDDVAWACDMYLMQLCSGIDENAIGACAQLVFAPIDESFADDALLLPSGFRIIPLDPKTDGLASTRTLDLASTLETGSGNARSAGESDSNNYNLRSVLTIAFQFTFENHLRDNVAVMARQYVRNVVRSVQRVAMAIAPSRLSTQLGPKSFPGPPEALTLARWICRSYRLHTCTELFSVESTSGDAILKQLWHHPDAILCCSVKTDASPVFTFANQAGLDMLETTLVALQDIMLDKVLDEAGRKVLCIEFSKIMQQGFAYLPAGICVSSMNRPVSYEQAIAWKVLDDDDSNHCLAFVFMNWSFV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo