Report for Sequence Feature Glyma05g29850
Feature Type: gene_model
Chromosome: Gm05
Start: 35331488
stop: 35333773
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma05g29850
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G13450 AT
Annotation by Michelle Graham. TAIR10: Adenine nucleotide alpha hydrolases-like superfamily protein | chr4:7815146-7815904 REVERSE LENGTH=219
SoyBase E_val: 9.00E-73 ISS
GO:0009827 GO-bp
Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification
SoyBase N/A ISS
GO:0009860 GO-bp
Annotation by Michelle Graham. GO Biological Process: pollen tube growth
SoyBase N/A ISS
GO:0048610 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular process involved in reproduction
SoyBase N/A ISS
GO:0048868 GO-bp
Annotation by Michelle Graham. GO Biological Process: pollen tube development
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PF00582 PFAM
Universal stress protein family
JGI ISS
UniRef100_G7L828 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Universal stress protein family protein n=1 Tax=Medicago truncatula RepID=G7L828_MEDTR
SoyBase E_val: 6.00E-95 ISS
UniRef100_I1K466 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K466_SOYBN
SoyBase E_val: 8.00E-155 ISS
Expression Patterns of Glyma05g29850
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma05g29850
Paralog Evidence Comments
Glyma08g12950 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma05g29850 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.05g165400 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma05g29850
Coding sequences of Glyma05g29850
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma05g29850.1 sequence type=CDS gene model=Glyma05g29850 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCGCAAGGCATGGCGAGTAACCGCAACCGGAGCGCGAGCGCGCAAGAAGCCCGCAAGGTGATGGTGGTGGCGGACCCGACGCGGGAATCGGCGGGCGCGTTGCAGTACGCGCTGGCGCATGCGGTGATCGAGCAAGACGAGCTGATTCTGCTGCACGTTGAGAACCCTAGCTCGTGGCGCCACACCATTTCGACGTTCCTGAAGATGCCGTCGTTGGGAAGCTCAACCACTGCGTCGCTGGACCTTGGAGGAGGGGGAGCCGCGGCGGATGGAGAAGGGTTCGATTTTCTGGAGGAGATGAAGCATGCATGCAGGGTTTCTCAGCCGAAAATGAAGGTGCGTGTGATGAAGGTGGAGACCGATGGAAGAGACAAGGCTAGCACTATTCTTTCTCAGAGCAAAACGCATGGGGTTGATGTCGTAGTTATAGGCCAGAAGCGCAATATTACTTCGGCGTTATTAGGATATAAGCGACCTGCAGGTGGATCTATGAAAGGGGTGAAAGCGATAGACACTGCAGAGTATTTGATTCAAAACAGTTCGTGCACCTGTGTTAGTGTACAGAGAAAAGGCCAAAATGGAGGCTTTGTTCTCAACTCCAAAACCCACAGAAATTTCTGGCTCTTAGCCTAA
Predicted protein sequences of Glyma05g29850
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma05g29850.1 sequence type=predicted peptide gene model=Glyma05g29850 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAQGMASNRNRSASAQEARKVMVVADPTRESAGALQYALAHAVIEQDELILLHVENPSSWRHTISTFLKMPSLGSSTTASLDLGGGGAAADGEGFDFLEEMKHACRVSQPKMKVRVMKVETDGRDKASTILSQSKTHGVDVVVIGQKRNITSALLGYKRPAGGSMKGVKAIDTAEYLIQNSSCTCVSVQRKGQNGGFVLNSKTHRNFWLLA*