Glyma05g28700 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g28700

Feature Type:	gene_model
Chromosome:	Gm05
Start:	34500802
stop:	34501746
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g28700

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G13600	AT	Annotation by Michelle Graham. TAIR10: Carbohydrate-binding X8 domain superfamily protein \| chr4:7911179-7912892 REVERSE LENGTH=231	SoyBase	E_val: 3.00E-35	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
PTHR16631	Panther	GLUCAN 1,3-BETA-GLUCOSIDASE-RELATED	JGI		ISS
PTHR16631:SF1	Panther	GLUCAN 1,3-BETA-GLUCOSIDASE	JGI		ISS
PF07983	PFAM	X8 domain	JGI		ISS
UniRef100_G7LHW7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Glucan endo-1 3-beta-glucosidase n=1 Tax=Medicago truncatula RepID=G7LHW7_MEDTR	SoyBase	E_val: 1.00E-42	ISS
UniRef100_I1K3U7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K3U7_SOYBN	SoyBase	E_val: 3.00E-102	ISS

Expression Patterns of Glyma05g28700

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g28700

Paralog	Evidence	Comments
Glyma08g11825	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g28700 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g154400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g28700

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g28700

Limit To All Plant Sequences

>Glyma05g28700.1   sequence type=CDS   gene model=Glyma05g28700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATCATCAACAGCAAAAGTGGTTTCTCTAGTGTTAATAGTAGTAGGGAGAATGATGATGAATATTGTGGAAGCAAACACTTGGTGCGTGGCAAGGAGCAACGCTGGCTACGGAGCACTGAAGTCAGGGTTGGACTTTGCATGCTCACATGGAGCTGACTGTAGGGCAATTCAACCCGGTGGCAGTTGCTTCAATCCGAACACCATTCAAAACCATGCTTCTTATGCCTTTGACAGTTACTATCAGAGAAATGGCAAAAACCCTGGTGCATGTAACTTTGGTGGTGCAGCCACCATTGCCGTTTCTGATCCCAGCTTTGGACGTTGTGTGTACCCACCTTCTTCGAGCACTGATGGAGGAGTTGATACAACAATCACGGGGCTTCCAATGAACAGCAAGACATTACAAGACCAGACCAACAAGGAGGATTGA

Predicted protein sequences of Glyma05g28700

Limit To All Plant Sequences

>Glyma05g28700.1   sequence type=predicted peptide   gene model=Glyma05g28700   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASSTAKVVSLVLIVVGRMMMNIVEANTWCVARSNAGYGALKSGLDFACSHGADCRAIQPGGSCFNPNTIQNHASYAFDSYYQRNGKNPGACNFGGAATIAVSDPSFGRCVYPPSSSTDGGVDTTITGLPMNSKTLQDQTNKED*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain