SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g28210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g28210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g28210

Feature Type:gene_model
Chromosome:Gm05
Start:34095241
stop:34099028
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g28210
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G10340AT Annotation by Michelle Graham. TAIR10: light harvesting complex of photosystem II 5 | chr4:6408200-6409496 FORWARD LENGTH=280 SoyBaseE_val: 5.00E-58ISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009765GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light harvesting SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010155GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of proton transport SoyBaseN/AISS
GO:0010196GO-bp Annotation by Michelle Graham. GO Biological Process: nonphotochemical quenching SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009517GO-cc Annotation by Michelle Graham. GO Cellular Compartment: PSII associated light-harvesting complex II SoyBaseN/AISS
GO:0009533GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stromal thylakoid SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: photosystem II antenna complex SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0030076GO-cc Annotation by Michelle Graham. GO Cellular Compartment: light-harvesting complex SoyBaseN/AISS
GO:0016168GO-mf Annotation by Michelle Graham. GO Molecular Function: chlorophyll binding SoyBaseN/AISS
PTHR21649Panther CHLOROPHYLL A/B BINDING PROTEIN JGI ISS
PF00504PFAM Chlorophyll A-B binding protein JGI ISS
PF03759PFAM PRONE (Plant-specific Rop nucleotide exchanger) JGI ISS
UniRef100_B9S1T5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chlorophyll A/B binding protein, putative n=1 Tax=Ricinus communis RepID=B9S1T5_RICCO SoyBaseE_val: 6.00E-65ISS
UniRef100_I1K3P6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1K3P6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g28210
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g28210 not represented in the dataset
Glyma05g28210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma05g28210 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g149400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g28210
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g28210
>Glyma05g28210.3   sequence type=CDS   gene model=Glyma05g28210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGATGTCGTCGTAGGCCTCCGGCCAGTCTACGACGGTCTCCTTCCACCGTTTTAGAAACACACGATTCCTGCGACGGGGATGACGGGAGGCCCGTAGTTGCAAGTTCACCTTCGAAGACATTGCCGGCACGAGGAACAACGTTGAAAGGTAAGGTCTACTATGTCGTTGCACCGGCAACGACCGCCGTTGAATGGTTGGCCAACTACGTCGTTGCTGCCGAAATATTGGATAGTTTCCAGGATACTGAATTTTGGTACGCGGAGCAAGGGACCATATCAGGGAATTCAACTCGGTCACGGGGAGGCTCATTTCGAAGGATTGTTCAGAGGAAAGATGAGAAGTGGTGGCTGCCGGTTCCTTGTGTTCACCTTGGGGGCCTTATTGATAAGTCAAGGAAGCACTTGAATGAGAAAAGAGATTGTGCTAATCAAATTCATAAAGCTGCAATGGCTATAAATAGCAGTGCTCTTGCAGAGATGGATATCCCAGAAACATATATGTCTAATCTTCCCAAGCATTCAGCAGCAGAATTCAGCAGTCAAGATTCAACAGATTCAGCAGCAGCAGATTGCAGAAAAGTGGAAATTGCAGATTCAGCAGCAGCCACTGCCTCTAAATCTATTCTTGCTGTTGTTGCTGAGATAGTTCTTGTGGGTGGTGCTGAGTACTACAGAATTATTAATGGCCTGGACTTGGAAGACAAGCTTCATCCGGGTGGTCCATTCGACCCATTGGGACTAGCAAAGGATCCAGACCAAGCTGCACTTCTAAAGGTGAAGGAAATTAAGAATGGTAGACTTGCTATGTTTGCAATGCTTGGTTTCTACTTCCAAGCATATGTCACTGGAGAAGGTCCAGTTGAGAACTTAGCAAAACATCTCAGTGACCCTTTTGGTAACAACTTGCTCACTGTGATTGCTGGCTCCACTGAGAGGGCTCCAACTCTGTAA
Predicted protein sequences of Glyma05g28210
>Glyma05g28210.3   sequence type=predicted peptide   gene model=Glyma05g28210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRCRRRPPASLRRSPSTVLETHDSCDGDDGRPVVASSPSKTLPARGTTLKGKVYYVVAPATTAVEWLANYVVAAEILDSFQDTEFWYAEQGTISGNSTRSRGGSFRRIVQRKDEKWWLPVPCVHLGGLIDKSRKHLNEKRDCANQIHKAAMAINSSALAEMDIPETYMSNLPKHSAAEFSSQDSTDSAAADCRKVEIADSAAATASKSILAVVAEIVLVGGAEYYRIINGLDLEDKLHPGGPFDPLGLAKDPDQAALLKVKEIKNGRLAMFAMLGFYFQAYVTGEGPVENLAKHLSDPFGNNLLTVIAGSTERAPTL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo