SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g27450

Feature Type:gene_model
Chromosome:Gm05
Start:33381965
stop:33382883
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g27450
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G30260AT Annotation by Michelle Graham. TAIR10: BEST Arabidopsis thaliana protein match is: Galactosyltransferase family protein (TAIR:AT4G21060.1); Has 30 Blast hits to 30 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:10651159-10651452 FORWARD LENGTH=97 SoyBaseE_val: 5.00E-16ISS
GO:0009735GO-bp Annotation by Michelle Graham. GO Biological Process: response to cytokinin stimulus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_I1K3H0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1K3H0_SOYBN SoyBaseE_val: 9.00E-39ISS

Expression Patterns of Glyma05g27450
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g27450
ParalogEvidenceComments
Glyma08g10435 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g27450 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g143000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g27450
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g27450
>Glyma05g27450.2   sequence type=CDS   gene model=Glyma05g27450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAATTCTCGCATTGCTAGGTTCTTCATGGAGGTGGCACCACCACAGTATGTTACTGTGATGAGGCACAGAACATCAAAGATGTTGGACACTATTACTGAAGATGAGAGGGAGATTAGCACCAGTGATTCTGTCATGTCACCCCCTAAAAAAAGCAAATCAGCAGTAGCAGTTGCAGCTTCATCTGCTTCTGCTTCTGTTACCAATGTTAAGGGAAGGTGCTTCCTCAAGGAAGTGCATAGATCCCTCTCAATTTTGAATCAGTGA
Predicted protein sequences of Glyma05g27450
>Glyma05g27450.2   sequence type=predicted peptide   gene model=Glyma05g27450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANSRIARFFMEVAPPQYVTVMRHRTSKMLDTITEDEREISTSDSVMSPPKKSKSAVAVAASSASASVTNVKGRCFLKEVHRSLSILNQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo