SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g26570

Feature Type:gene_model
Chromosome:Gm05
Start:32502359
stop:32503719
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g26570
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G18420AT Annotation by Michelle Graham. TAIR10: Protein prenylyltransferase superfamily protein | chr3:6324771-6325721 REVERSE LENGTH=316 SoyBaseE_val: 2.00E-102ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
PTHR26312Panther FAMILY NOT NAMED JGI ISS
PTHR26312:SF65Panther JGI ISS
UniRef100_I1K395UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K395_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q9LS48UniRef Annotation by Michelle Graham. Most informative UniRef hit: AT3g18420/MYF24_13 n=1 Tax=Arabidopsis thaliana RepID=Q9LS48_ARATH SoyBaseE_val: 9.00E-100ISS

Expression Patterns of Glyma05g26570
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g26570
ParalogEvidenceComments
Glyma08g09550 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g26570 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g135200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g26570
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g26570
>Glyma05g26570.1   sequence type=CDS   gene model=Glyma05g26570   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGACTTCAGTATCATCATCCTCCATCTTCTCCTTCACCCCCAAAACCCTAACCACACCCCCACATCAATCTCGTTTCACCGTCCGGGCCCACTCCAAACCCCCCATTTTCCCCAACCTCAAAACCCTCGCTGGCGCCGCGGTCTTCGCCGCCGTCGCGCTCCAATTCCCCGCCGCCGCCGCACGCGCCTCCCCGCCGCCGCCGCCCCCTCTCGAAACCGAGTCCCTCTCCCCTCTCTCCGACCTCCTCGAGACCAACACCGAGGCCCTCGCCGCGCTCAAGTCCCTCCTCCAGCAGAAGCTCGAGCTCGGAGAAGACGACGAAGCGTTCTCCATCCTCAAGCGCCTCATCGCCGCGCAGCCCGACGCCGCCGACTGGAAGTTCCTGGCGGCGCGCCTCGCCGCGGAGACCGGCGACGTCGAGGCCGCGCGCGGCTACTACCAGGAGGTCCTCGCCGCGAACCCGCTCTCCTTCGAGGCGCTCTTCGAGAACGCACTGCTGATGGACCGGTGCGGCGAGGGCGAGGCAGCGATGCGGCGCCTGGAGGAGGCGCTGCGCGTGGCGGAGGAGGACAAGAAGGCGAAGGAAGCCAGGGACGTGAAGCTGATCATGGCGCAGATCACGTTTCTGCAGAAGAACGTGGATGAAGCGTTAGGGATTTATAATCAGCTCACGAAAGAGGATCCAAGGGATTTCAGGCCTTATTTTTGTAGAGGCATGATTTATAGCTTGCTTGATAGAAATGAAGAAGCTAAGGAGCAGTTTGCAAAATACAGAGAATTGAGTCCAAAGAAGTTTGAGGTTGATGGGTATTTGAGGACCCCTTTGTCAAGGATGAAGCTTTTTAGCACCGATGAGAGCTGA
Predicted protein sequences of Glyma05g26570
>Glyma05g26570.1   sequence type=predicted peptide   gene model=Glyma05g26570   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLTSVSSSSIFSFTPKTLTTPPHQSRFTVRAHSKPPIFPNLKTLAGAAVFAAVALQFPAAAARASPPPPPPLETESLSPLSDLLETNTEALAALKSLLQQKLELGEDDEAFSILKRLIAAQPDAADWKFLAARLAAETGDVEAARGYYQEVLAANPLSFEALFENALLMDRCGEGEAAMRRLEEALRVAEEDKKAKEARDVKLIMAQITFLQKNVDEALGIYNQLTKEDPRDFRPYFCRGMIYSLLDRNEEAKEQFAKYRELSPKKFEVDGYLRTPLSRMKLFSTDES*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo