Glyma05g26480 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g26480

Feature Type:	gene_model
Chromosome:	Gm05
Start:	32434397
stop:	32439572
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g26480

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G47630	AT	Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: Mitochondrial matrix Mmp37 (InterPro:IPR015222); Has 35333 Blast hits to 34131 proteins in 2444 species: Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI BLink). \| chr3:17563254-17565162 REVERSE LENGTH=332	SoyBase	E_val: 1.00E-152	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
KOG2986	KOG	Uncharacterized conserved protein	JGI		ISS
PTHR13619	Panther	UNCHARACTERIZED	JGI		ISS
PF09139	PFAM	Mitochondrial matrix Mmp37	JGI		ISS
UniRef100_G8A1V5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: MMP37-like protein n=1 Tax=Medicago truncatula RepID=G8A1V5_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI000233A9E1	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233A9E1 related cluster n=1 Tax=unknown RepID=UPI000233A9E1	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma05g26480

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g26480

Paralog	Evidence	Comments
Glyma08g09410	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g26480 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g134300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g26480

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g26480

Limit To All Plant Sequences

>Glyma05g26480.1   sequence type=CDS   gene model=Glyma05g26480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATAATGCAACATTTCGAAGTTTTCTTCAGGTTCTTCCCCCTGTTGAATTTGCATGCGTCTATGGATCATCTCTTCATCCATCCAACCACGACAAGACAACCATGACAGATTATATTCTTGGCGTGTCTGATCCAAAGCAGTGGCATTCTGAGAATCTGAAATTGAACAAGCATCACTATGCGTCATGGATGGTGCACCTTGGTGGCGAGAGCCTGATTACTGGAGTTGCTGATAGAATTGGTGTGGGAGTGCATTTCAACCCTTTTGTTACTTGGAATGGAAAGCTGTTCAAGTATGGGGTTATACAAATGCATGACTTACTTCAAGATGTTCAGTATTGGGAGAAATTCTACTTGTGTGGCCGGTTACAGAAACCAGTTCATATTGTTGTCGATAATTTAGATGTCAACAGCACCAATTCTGTTAACTTGAGAGCTGCAGTGTCAGCTGCTCTTCTCCTGCTTCCATCAGAATTCACAGAGGAAGATCTATATGCCAAAGTATGTAGTCTCTCATACACAGGTGATATACGCATGTTATTTGCTGAGGATAAAAACAAGGTGAAAAAGATTGTTACTGGGCAGTTTGATCTATTCCACTCAATGTATAAGCCATTTCTTGAAGAATATGAGGCTAAGAAGTTATTGAGACTTTCATCAACTGCCAATAATCAAATACATGCCACTCAGGATTGTGACTTATCAGTTGCTTGTGCTCTAGTTTCTGCTCTTCCTCCATCAATCAGAAGCCAGATAAGCAAGAACGGAGAATTAACGGAAACTGGTAGATTCATACATGATACTAAAGTCAGTGCAAGAGAAGTGGCTGCAAATTGCTTGCAGAGAATTCTGAGGCAAAGAGTAATGGTTTCAAGTGCAAGGCAGGCCATATCTGGCCTTCTGGCTGTTGGTGGGGTAAATGCTACCAGGTATCTTTCTAAGAAAGTTAGCAAAGCCTGGAGATCATGGAGATGA

Predicted protein sequences of Glyma05g26480

Limit To All Plant Sequences

>Glyma05g26480.1   sequence type=predicted peptide   gene model=Glyma05g26480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDNATFRSFLQVLPPVEFACVYGSSLHPSNHDKTTMTDYILGVSDPKQWHSENLKLNKHHYASWMVHLGGESLITGVADRIGVGVHFNPFVTWNGKLFKYGVIQMHDLLQDVQYWEKFYLCGRLQKPVHIVVDNLDVNSTNSVNLRAAVSAALLLLPSEFTEEDLYAKVCSLSYTGDIRMLFAEDKNKVKKIVTGQFDLFHSMYKPFLEEYEAKKLLRLSSTANNQIHATQDCDLSVACALVSALPPSIRSQISKNGELTETGRFIHDTKVSAREVAANCLQRILRQRVMVSSARQAISGLLAVGGVNATRYLSKKVSKAWRSWR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain