SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g26230

Feature Type:gene_model
Chromosome:Gm05
Start:32233838
stop:32237482
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g26230
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G30950AT Annotation by Michelle Graham. TAIR10: FtsH extracellular protease family | chr2:13174692-13177064 FORWARD LENGTH=695 SoyBaseE_val: 0ISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010205GO-bp Annotation by Michelle Graham. GO Biological Process: photoinhibition SoyBaseN/AISS
GO:0010206GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II repair SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010304GO-bp Annotation by Michelle Graham. GO Biological Process: PSII associated light-harvesting complex II catabolic process SoyBaseN/AISS
GO:0030163GO-bp Annotation by Michelle Graham. GO Biological Process: protein catabolic process SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042744GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process SoyBaseN/AISS
GO:0042793GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0072593GO-bp Annotation by Michelle Graham. GO Biological Process: reactive oxygen species metabolic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0031977GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid lumen SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004176GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP-dependent peptidase activity SoyBaseN/AISS
GO:0004222GO-mf Annotation by Michelle Graham. GO Molecular Function: metalloendopeptidase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008237GO-mf Annotation by Michelle Graham. GO Molecular Function: metallopeptidase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
KOG0731 KOG AAA+-type ATPase containing the peptidase M41 domain JGI ISS
PTHR23076Panther METALLOPROTEASE M41 FTSH JGI ISS
PTHR23076:SF34Panther JGI ISS
PF00004PFAM ATPase family associated with various cellular activities (AAA) JGI ISS
PF01434PFAM Peptidase family M41 JGI ISS
PF06480PFAM FtsH Extracellular JGI ISS
UniRef100_F6M9W9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Filamentation temperature-sensitive H n=1 Tax=Glycine max RepID=F6M9W9_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1K360UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K360_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g26230
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g26230
ParalogEvidenceComments
Glyma08g09160 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g26230 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g132000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g26230
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g26230
>Glyma05g26230.1   sequence type=CDS   gene model=Glyma05g26230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGCGTCATCAGCATGCCTTGTAGGGAATGGTTTATCTACACGGGGTAATAGAATAACTCTCAAGAAGGACTTCAATGGAAGATATCTCTACTCACCTTGGAGACTTTCATCATTGAACAATAAGGCATCAGAAGCATTTTCCATAAAGTCTTCCTTGGAGCAAAGGCAACAACAAGAAGGGAGAAGGGGGTTTCTAAAACTGTTGCTTGGAAATGTGGGAGTTGGTTTGCCTGCACTATTGGCAAGTGGCAAAGCTTATGCTGATGAACAAGGGGTTTCCTCCTCCAGAATGTCTTACTCCAGGTTTCTGGAGTATTTGGACAAGGACAGAGTTAAAAAAGTGGATCTGTATGACAATGGAAACACTGCTGTTGTTGAGGCTGTTTCTCCCGAGTTGGGGAATCGGTTGCAGTATGTTAGAGTTCAACTCCCTGGACTTAACCAAGAGCTCCTTCAGAAATTCAGGGAAAAGAATATTGACTTTGCAGCTCATAGTCCCCAAGAAGAGTCAGGTTCTCTTTTAGCTAACCTGATTGGGAATCTGGCTTTCCCTTTGATCTTGATTGGAGGATTGTTCCTTCTCTCGAGACGATCCGGAGGGATGGGAGGTCCTGGTGGGCCCGGATTTCCTCTTGCTTTTGGTCAATCCAAAGCCAAGTTTCAAATGGAACCGAACACCGGAGTGACATTTGATGATGTTGCTGGGGTGGATGAAGCCAAGCAGGACTTTATGGAGGTTGTGGAGTTTCTAAAGAAGCCTGAGAGGTTCACTGCTGTTGGGGCTCGCATACCGAAAGGAGTTCTTCTTGTTGGTCCTCCAGGAACTGGGAAGACACTGTTAGCCAAGGCTATTGCTGGTGAAGCTGGTGTTCCATTTTTCTCAATATCAGGTTCTGAGTTTGTTGAGATGTTTGTTGGTGTTGGTGCTTCTCGTGTTCGTGATTTGTTCAAGAAGGCCAAAGAGAATGCCCCTTGCATTGTCTTTGTTGATGAAATTGATGCTGTTGGAAGACAAAGAGGGACTGGAATTGGTGGTGGGAATGATGAAAGAGAGCAGACCCTCAACCAACTTTTGACAGAAATGGATGGGTTTGAGGGTAACACTGGTATCATTGTCGTTGCAGCAACTAACAGGGCTGACATTCTTGACTCTGCCTTATTGAGACCGGGTCGGTTTGATAGACAGGTGACAGTTGATGTTCCAGATATAAGGGGAAGGACTGAAATCCTAAAGGTTCATGCTAGCAACAAAAAGTTTGATGCTGATGTTTCTCTTGAAGTGATTGCGATGAGAACGCCTGGCTTTAGTGGAGCTGATCTTGCGAATCTCTTGAATGAAGCTGCTATATTAGCTGGTCGCCGGGGAAAGACAGGTATTTCATCTAAAGAAATCGATGATTCTATTGATAGGATTGTGGCTGGAATGGAAGGAACAGTTATGACAGATGGGAAGAGCAAAAGCTTAGTGGCATATCATGAAGTTGGGCATGCTATTTGTGGAACTTTGACTCCTGGTCATGATGCTGTGCAAAAGGTAACACTAGTTCCTCGTGGTCAAGCTCGGGGTCTTACATGGTTCATTCCTAATGATGATCCAACTCTGATCTCCAAACAACAACTCTTTGCAAGAATTGTTGGAGGACTAGGTGGAAGGGCTGCAGAAGAAATTATTTTTGGTGAGCCTGAAGTTACAACTGGAGCAGCTGGTGATTTGCAGCAAATCACCGGTTTGGCAAAACAGATGGTAACCACATTTGGAATGTCTGATATTGGTCCTTGGTCACTTATGGAAGCATCAGCACAAAGTGGGGATGTCATCATGAGAATGATGGCAAGGAACTCAATGTCAGAGAGACTTGCAGAAGACATCGATGCTGCCATCAAGAGGATCTCAGATGAAGCATATGAAATTGCACTAGACCATATAAGGAACAACCGTGAGGCGATTGACAAGATTGTCGAAGTCCTTCTGGAGAAGGAGACACTGACCGGAGATGAATTCCGTGCTATATTGTCTGAGTTTGCTGAAATTCCAGTTGAAAACCGTGTCCCTCCTTCAACTCCAGTACCAGCCACTGTTTGA
Predicted protein sequences of Glyma05g26230
>Glyma05g26230.1   sequence type=predicted peptide   gene model=Glyma05g26230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAASSACLVGNGLSTRGNRITLKKDFNGRYLYSPWRLSSLNNKASEAFSIKSSLEQRQQQEGRRGFLKLLLGNVGVGLPALLASGKAYADEQGVSSSRMSYSRFLEYLDKDRVKKVDLYDNGNTAVVEAVSPELGNRLQYVRVQLPGLNQELLQKFREKNIDFAAHSPQEESGSLLANLIGNLAFPLILIGGLFLLSRRSGGMGGPGGPGFPLAFGQSKAKFQMEPNTGVTFDDVAGVDEAKQDFMEVVEFLKKPERFTAVGARIPKGVLLVGPPGTGKTLLAKAIAGEAGVPFFSISGSEFVEMFVGVGASRVRDLFKKAKENAPCIVFVDEIDAVGRQRGTGIGGGNDEREQTLNQLLTEMDGFEGNTGIIVVAATNRADILDSALLRPGRFDRQVTVDVPDIRGRTEILKVHASNKKFDADVSLEVIAMRTPGFSGADLANLLNEAAILAGRRGKTGISSKEIDDSIDRIVAGMEGTVMTDGKSKSLVAYHEVGHAICGTLTPGHDAVQKVTLVPRGQARGLTWFIPNDDPTLISKQQLFARIVGGLGGRAAEEIIFGEPEVTTGAAGDLQQITGLAKQMVTTFGMSDIGPWSLMEASAQSGDVIMRMMARNSMSERLAEDIDAAIKRISDEAYEIALDHIRNNREAIDKIVEVLLEKETLTGDEFRAILSEFAEIPVENRVPPSTPVPATV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo