SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g25010

Feature Type:gene_model
Chromosome:Gm05
Start:31166482
stop:31167417
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g25010
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G43660AT Annotation by Michelle Graham. TAIR10: Vacuolar iron transporter (VIT) family protein | chr3:15565332-15565928 FORWARD LENGTH=198 SoyBaseE_val: 7.00E-80ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005575GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cellular component SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG4473 KOG Uncharacterized membrane protein JGI ISS
PF01988PFAM VIT family JGI ISS
UniRef100_P16313UniRef Annotation by Michelle Graham. Best UniRef hit: Nodulin-21 n=2 Tax=Glycine max RepID=NO21_SOYBN SoyBaseE_val: 2.00E-147ISS
UniRef100_P16313UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nodulin-21 n=2 Tax=Glycine max RepID=NO21_SOYBN SoyBaseE_val: 2.00E-147ISS

Expression Patterns of Glyma05g25010
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g25010
ParalogEvidenceComments
Glyma08g08120 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g25010 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g121600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g25010
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g25010
>Glyma05g25010.1   sequence type=CDS   gene model=Glyma05g25010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTGTTGTGTCACCGAAAATGGCTAATGCTACACCTAATGGTTCGGTGCCACATAACCATGTAGGAGCAGTACTTCTAACAATTCCCACAATCAAAATTGATGGGAAGCAAACCCTAGCCACCGAAGATCACACCAGCATTGACTATTTACAGAGGGCACAGTGGCTTCGTGCAGCGATTTTAGGAGCCAATGATGGGTTGGTTTCGGTTGCATCGTTGATGATGGGTGTAGGAGCTGTTAAAAGAGATGCAAAAGCTATGCTACTTGCTGGTTTTGCAGGGTTAGTTGCTGGGGCTTGTGGCATGGCAATAGGAGAGTTTGTTGCTGTGTACACTCAGTATGAGGTAGAGGTAGGTCAAATGAAGAGAGATATGAATATGAGTGTGGGAGGGGAGAGAGACTTGGAGATGGAGATGGAGAGAAGAACATTGCCTAATCCATTGCAAGCTACTTTGGCATCAGCACTCTGCTTTTCTATAGGTGCATTGGTGCCTCTACTTTCTGCTGCTTTCATTGAAAACTACAGGACTAGGATTATTGTGGTTGTGGCAATGTCTTGTTTGGCTTTGGTGGTGTTTGGATGGGTGGGCGCTAAGCTGGGAAAAACTCCCAAGTTAAAATCTTGTGTAAGGTTCCTTCTTGGAGGATGCATAGCCATGTCCATCACTTTTGGCTCAACTAAATTACTTGGTGCTAGCGCATTATAA
Predicted protein sequences of Glyma05g25010
>Glyma05g25010.1   sequence type=predicted peptide   gene model=Glyma05g25010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVVVSPKMANATPNGSVPHNHVGAVLLTIPTIKIDGKQTLATEDHTSIDYLQRAQWLRAAILGANDGLVSVASLMMGVGAVKRDAKAMLLAGFAGLVAGACGMAIGEFVAVYTQYEVEVGQMKRDMNMSVGGERDLEMEMERRTLPNPLQATLASALCFSIGALVPLLSAAFIENYRTRIIVVVAMSCLALVVFGWVGAKLGKTPKLKSCVRFLLGGCIAMSITFGSTKLLGASAL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo