SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g24990

Feature Type:gene_model
Chromosome:Gm05
Start:31157673
stop:31158339
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g24990
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G43660AT Annotation by Michelle Graham. TAIR10: Vacuolar iron transporter (VIT) family protein | chr3:15565332-15565928 FORWARD LENGTH=198 SoyBaseE_val: 5.00E-74ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005575GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cellular component SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF01988PFAM VIT family JGI ISS
UniRef100_I1KR67UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KR67_SOYBN SoyBaseE_val: 7.00E-93ISS
UniRef100_Q9M2C0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Vacuolar iron transporter homolog 4 n=1 Tax=Arabidopsis thaliana RepID=VITH4_ARATH SoyBaseE_val: 2.00E-71ISS

Expression Patterns of Glyma05g24990
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma05g24990 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g121400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g24990
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g24990
>Glyma05g24990.2   sequence type=CDS   gene model=Glyma05g24990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAACCTTGGAGCTAGAACCAATGGAATTTCATCAACTAACCAAGTGGAGATTCCTATGCATGTGTATGGTGTGGAACCAACACAAAGTGAAGAGAGCCACATAGACTACTCTCAGAGGGCTCAGTGGCTTCGAGCCGCGGTGTTGGGAGCCAATGATGGGTTGGTCTCAGTTTCCTCACTGATGATGGGTGTTGGAGCTGTTAAGAAAGACATCAGTGCCATGATTCTTGCTGGTTTTGCAGGATTAGTTGCTGGGGCTTGTAGCATGGCAATTGGAGTTTTTAATGAAGAAGCTCGAAGGGGGAAGCTTCCAAATCCATTTCAGGCTGCACTAGCATCAGCATTTGCATTTTCTGTTGGTGCTTTGGTGCCAATGCTTGCTGCTGTGTTTATAAGGAGTCACAAGGTTAGAATGGGAGTTGTTGCTGCTGCAGTTAGCGTGGCATCGTTGATGTTTGGAGGGGCAGGAGCTGTTCTTGGAAAAACTCCAGTGACAAGATCTTGCATTAGGGTTCTGGTTGGAGGTTGGATGGCTATGGCCATAACATTTGGCCTCACCAAATTGATTGGCTCTTCTGATCTTTGA
Predicted protein sequences of Glyma05g24990
>Glyma05g24990.2   sequence type=predicted peptide   gene model=Glyma05g24990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANLGARTNGISSTNQVEIPMHVYGVEPTQSEESHIDYSQRAQWLRAAVLGANDGLVSVSSLMMGVGAVKKDISAMILAGFAGLVAGACSMAIGVFNEEARRGKLPNPFQAALASAFAFSVGALVPMLAAVFIRSHKVRMGVVAAAVSVASLMFGGAGAVLGKTPVTRSCIRVLVGGWMAMAITFGLTKLIGSSDL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo