SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g24960): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g24960): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g24960

Feature Type:gene_model
Chromosome:Gm05
Start:31133960
stop:31137426
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G26420AT Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein with retrovirus zinc finger-like domain | chr3:9671953-9673055 FORWARD LENGTH=245 SoyBaseE_val: 1.00E-68ISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009631GO-bp Annotation by Michelle Graham. GO Biological Process: cold acclimation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG0114 KOG Predicted RNA-binding protein (RRM superfamily) JGI ISS
PTHR24012Panther FAMILY NOT NAMED JGI ISS
PTHR24012:SF188Panther JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
PF00098PFAM Zinc knuckle JGI ISS
UniRef100_B9SCP7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Dc50, putative n=1 Tax=Ricinus communis RepID=B9SCP7_RICCO SoyBaseE_val: 1.00E-78ISS
UniRef100_C6TJJ8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TJJ8_SOYBN SoyBaseE_val: 1.00E-139ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g24960 not represented in the dataset

Glyma05g24960 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma08g08051 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g121100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g24960.1   sequence type=CDS   gene model=Glyma05g24960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTGACGTGGAAGAGTTTCGTTGCTTCATTGGTGGCCTTGCATGGTCAACGTCTGATAGAAAGTTAAAGGATACATTTGAAAAGTTTGGCAAGCTTATTGAGGCAAAGGTGGTTGTTGACAAGTTCTCTGGGCGTTCTCGTGGTTTTGGATTTGTCACATTTGATGACAAGAAAGCAATGGACGAGGCTATTGATGCTATGAATGGGATAGATTTAGACGGGCGAACTATTACTGTTGATAGAGCTCAGCCTCAACAAGGATCAACTAGAGATGATGGTGATCGTTACCGGGAGCGTGGTCGTGATCGTGATCGTAACCGAGATTATGGAGGTGGAGGTGGTCGAGGATCTAATGGTGGTGAATGCTTTAAGTGTGGAAAACCTGGTCATTTTGCTAGGGAATGCCCTGGTGAAGGGTCCAGGGGAGGAAGGTATGGTGGTAGGGAAAGTAGATATGGTGGAAGCAGTGGTGGTGGTTATGGACCGGATAGAAATGCAGATCGTTCTTCAGGGGGGCGCAGCAGGGATGGTGGTAGTCATGGGGATTCTGGAAGTGATCGATATTATCGTGATCGTTCAGGACCATATGAGCGGGAGCGACGGGGATCGGGAGGCTTTCGTTGA

>Glyma05g24960.1   sequence type=predicted peptide   gene model=Glyma05g24960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSDVEEFRCFIGGLAWSTSDRKLKDTFEKFGKLIEAKVVVDKFSGRSRGFGFVTFDDKKAMDEAIDAMNGIDLDGRTITVDRAQPQQGSTRDDGDRYRERGRDRDRNRDYGGGGGRGSNGGECFKCGKPGHFARECPGEGSRGGRYGGRESRYGGSSGGGYGPDRNADRSSGGRSRDGGSHGDSGSDRYYRDRSGPYERERRGSGGFR*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo