Glyma05g24830 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g24830

Feature Type:	gene_model
Chromosome:	Gm05
Start:	31029524
stop:	31034530
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g24830

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G09700	AT	Annotation by Michelle Graham. TAIR10: Glycosyl hydrolase family protein \| chr5:3003720-3005566 REVERSE LENGTH=526	SoyBase	E_val: 3.00E-140	ISS
GO:0005975	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0004553	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds	SoyBase	N/A	ISS
PF01915	PFAM	Glycosyl hydrolase family 3 C terminal domain	JGI		ISS
UniRef100_A5JTQ3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Beta-xylosidase/alpha-L-arabinofuranosidase 2 n=1 Tax=Medicago sativa subsp. x varia RepID=XYL2_MEDSV	SoyBase	E_val: 1.00E-168	ISS
UniRef100_I1K2R5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K2R5_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma05g24830

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g24830

Paralog	Evidence	Comments
Glyma08g07950	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g24830 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g119900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g24830

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g24830

Limit To All Plant Sequences

>Glyma05g24830.1   sequence type=CDS   gene model=Glyma05g24830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTTCTGACTGTGACTCGGTAGAAGTGCTTTACAAATATCAGCACTACACCAAGACTCCTGAAGAAGCTGCAGCCATATCCATTCTGGCAGGGTTGGACTTGAACTGTGGAAGATTTCTTGGCCAATACACAGAAGGTGCTGTCAAGCAAGGGCTTATTGATGAATCCATTAACAATGCTGTCTCCAACAACTTCGCCACGTTGATGCGTCTAGGATTCTTTGATGGTGATCCAAGAAAGCAACCTTATGGAAACCTTGGACCAAAAGATGTCTGCACTCCAGCAAACCAGGAACTTGCCCGAGAAGCTGCAAGGCAAGGGATTGTGTCGCTGAAAAACAGTCCAGCATCACTGCCTCTCAACGCCAAAGCCATTAAATCGTTGGCAGTTATAGGACCCAATGCTAATGCTACTAGGGTCATGATTGGAAACTATGAAGGCATCCCATGTAAGTATATATCACCCTTGCAAGGCCTAACAGCCTTTGTTCCTACAAGCTATGCTGCCGGCTGTCTTGATGTGCGCTGCCCCAATCCAGTACTAGATGATGCAAAAAAGATTTCTGCCTCTGGAGATGCCACAGTAATTGTAGTCGGTGCAAGTCTAGCAATTGAGGCTGAAAGTCTAGACAGAGTCAACATTCTTCTTCCAGGACAGCAACAACTTCTAGTTACTGAAGTTGCAAATGCATCCAAGGGACCAGTGATTCTTGTCATAATGTCTGGAGGAGGCATGGATGTGTCCTTTGCTAAAGACAACAATAAAATCACAAGCATCTTGTGGGTTGGCTACCCCGGAGAAGCTGGTGGAGCTGCCATAGCGGATGTGATCTTTGGGTTTCATAATCCAGTTTGA

Predicted protein sequences of Glyma05g24830

Limit To All Plant Sequences

>Glyma05g24830.1   sequence type=predicted peptide   gene model=Glyma05g24830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVSDCDSVEVLYKYQHYTKTPEEAAAISILAGLDLNCGRFLGQYTEGAVKQGLIDESINNAVSNNFATLMRLGFFDGDPRKQPYGNLGPKDVCTPANQELAREAARQGIVSLKNSPASLPLNAKAIKSLAVIGPNANATRVMIGNYEGIPCKYISPLQGLTAFVPTSYAAGCLDVRCPNPVLDDAKKISASGDATVIVVGASLAIEAESLDRVNILLPGQQQLLVTEVANASKGPVILVIMSGGGMDVSFAKDNNKITSILWVGYPGEAGGAAIADVIFGFHNPV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain