SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g24740

Feature Type:gene_model
Chromosome:Gm05
Start:30943550
stop:30945786
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g24740
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G13830AT Annotation by Michelle Graham. TAIR10: DNAJ-like 20 | chr4:8011518-8012577 FORWARD LENGTH=197 SoyBaseE_val: 2.00E-15ISS
GO:0006457GO-bp Annotation by Michelle Graham. GO Biological Process: protein folding SoyBaseN/AISS
GO:0015996GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll catabolic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0031072GO-mf Annotation by Michelle Graham. GO Molecular Function: heat shock protein binding SoyBaseN/AISS
PTHR24076Panther FAMILY NOT NAMED JGI ISS
PF00226PFAM DnaJ domain JGI ISS
UniRef100_C6TDU4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TDU4_SOYBN SoyBaseE_val: 1.00E-133ISS
UniRef100_G7INT0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Chaperone protein dnaJ n=1 Tax=Medicago truncatula RepID=G7INT0_MEDTR SoyBaseE_val: 3.00E-47ISS

Expression Patterns of Glyma05g24740
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g24740
ParalogEvidenceComments
Glyma08g07900 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g24740 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g119200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g24740
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g24740
>Glyma05g24740.1   sequence type=CDS   gene model=Glyma05g24740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATGTTTTATCTTTAAGATCAAGTTCAAGCCTAAGCATGTCCAAGCCCTTTGAATCTCATGGCCTTCCACTCTCAAGTAAACAACATCGAAGACCTTCTAGTGTGAAGTTTGGTAGTGTTTCATGCAGAGCCACAACGTTAACCCAAGAAAACTTGTACAAAATATTATCTGTGAGTCCAGGAAGTGCAACAATGGATGAGATCAAGAGGGCTTATAGGTCAATGGCTCTTCAGTACCACCCTGATGTGTGCCATGATCCTTCCATGAAGGAGGAGTCAACGAGGATGTTTGTTCAGCTAAATGCAGCTTACGAGACCTTGTCCAATCCAAGGCTTAGAGAACAGTATGATAGTGAATTGGGTTTGAGAAGCGAAGTGATGAGTGTTAGTAGTGATCATGAGAGGTGGAGAAGTGTGAGTGTTAGTAGTGAACATGAGAGATGGGAAAGTAGGTTTCAGGAGCAAGTGATTGAGTTGAAGACAAGGTCTCGTAGACGTATGGGACAAAAGGGTGGATCATCGGGTAGCAGAATGAGGGCACCAAACATGAGAGACAGGAATTAA
Predicted protein sequences of Glyma05g24740
>Glyma05g24740.1   sequence type=predicted peptide   gene model=Glyma05g24740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDVLSLRSSSSLSMSKPFESHGLPLSSKQHRRPSSVKFGSVSCRATTLTQENLYKILSVSPGSATMDEIKRAYRSMALQYHPDVCHDPSMKEESTRMFVQLNAAYETLSNPRLREQYDSELGLRSEVMSVSSDHERWRSVSVSSEHERWESRFQEQVIELKTRSRRRMGQKGGSSGSRMRAPNMRDRN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo