Glyma05g24650 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g24650

Feature Type:	gene_model
Chromosome:	Gm05
Start:	30801130
stop:	30804966
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g24650

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G10160	AT	Annotation by Michelle Graham. TAIR10: Thioesterase superfamily protein \| chr5:3185819-3187159 FORWARD LENGTH=219	SoyBase	E_val: 3.00E-95	ISS
GO:0006633	GO-bp	Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process	SoyBase	N/A	ISS
GO:0006744	GO-bp	Annotation by Michelle Graham. GO Biological Process: ubiquinone biosynthetic process	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009534	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid	SoyBase	N/A	ISS
GO:0009941	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016836	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydro-lyase activity	SoyBase	N/A	ISS
GO:0019171	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity	SoyBase	N/A	ISS
PF07977	PFAM	FabA-like domain	JGI		ISS
UniRef100_B9SDU7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Hydroxyacyl-ACP Dehydrase n=1 Tax=Ricinus communis RepID=B9SDU7_RICCO	SoyBase	E_val: 1.00E-99	ISS
UniRef100_I1K2Q1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1K2Q1_SOYBN	SoyBase	E_val: 1.00E-123	ISS

Expression Patterns of Glyma05g24650

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g24650

Paralog	Evidence	Comments
Glyma08g07871	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g24650 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma05g24650

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g24650

Limit To All Plant Sequences

>Glyma05g24650.1   sequence type=CDS   gene model=Glyma05g24650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGATCATCTCATTCTTCTCAATCCAAATTTTCATCTCTCAGATTTCCAAGCTCGAACAACTAGGACAACACGGTTTACAACGTTTTGTTCTCTAGACGCTACAAATGATCCAAAAGAAAACACCCCAATTGAATTAAGTTACCCTGCGTTTCCAACATCATTGGATATCAATAAGATTCGTGACATTCTGCCGCACAGGTTTCCATTTCTTCTAGTGGATAGAGTGATTGAGCACAATCCTGGAGTTTCTGCAGTGGCCATAAAGAATGTGACAATAAATGACAACTTTTTTCCTGGGCATTTTCCAGAAAGACCAATCATGCCTGGTGTTCTCATGGCAATCGCACAAGTTGGTGGCTTGGTTATGTTGCAGCCTGAAGTTGGAGGTTCTCGTGAGAATTTCTTCTTTGCTGGAATAGACAAAGTGCGATTTAGGAAGCCAGTGATTGCAGGAGACACTTTAGTTATGAGAATGACACTTATCAAACTGCAAAAGCGATATGGAATAGCAAAAATGGAAGGAAAGGCATATGTTGGAGGTGAAGTTGTGTGTGACGGTGAGTTTTGA

Predicted protein sequences of Glyma05g24650

Limit To All Plant Sequences

>Glyma05g24650.1   sequence type=predicted peptide   gene model=Glyma05g24650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADHLILLNPNFHLSDFQARTTRTTRFTTFCSLDATNDPKENTPIELSYPAFPTSLDINKIRDILPHRFPFLLVDRVIEHNPGVSAVAIKNVTINDNFFPGHFPERPIMPGVLMAIAQVGGLVMLQPEVGGSRENFFFAGIDKVRFRKPVIAGDTLVMRMTLIKLQKRYGIAKMEGKAYVGGEVVCDGEF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain