SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g24070

Feature Type:gene_model
Chromosome:Gm05
Start:29984456
stop:29988124
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g24070
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G40610AT Annotation by Michelle Graham. TAIR10: NAD-dependent glycerol-3-phosphate dehydrogenase family protein | chr5:16265071-16267258 REVERSE LENGTH=400 SoyBaseE_val: 0ISS
GO:0006072GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol-3-phosphate metabolic process SoyBaseN/AISS
GO:0046167GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol-3-phosphate biosynthetic process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009331GO-cc Annotation by Michelle Graham. GO Cellular Compartment: glycerol-3-phosphate dehydrogenase complex SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004367GO-mf Annotation by Michelle Graham. GO Molecular Function: glycerol-3-phosphate dehydrogenase [NAD+] activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016614GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on CH-OH group of donors SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0042803GO-mf Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity SoyBaseN/AISS
GO:0050662GO-mf Annotation by Michelle Graham. GO Molecular Function: coenzyme binding SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
KOG2711 KOG Glycerol-3-phosphate dehydrogenase/dihydroxyacetone 3-phosphate reductase JGI ISS
PTHR11728Panther GLYCEROL-3-PHOSPHATE DEHYDROGENASE JGI ISS
PF01210PFAM NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus JGI ISS
PF07479PFAM NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus JGI ISS
UniRef100_H6TBK2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Plastid glycerol-3-phosphate dehydrogenase n=1 Tax=Jatropha curcas RepID=H6TBK2_9ROSI SoyBaseE_val: 0ISS
UniRef100_UPI00023396A0UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00023396A0 related cluster n=1 Tax=unknown RepID=UPI00023396A0 SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g24070
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g24070
ParalogEvidenceComments
Glyma19g07410 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g24070 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g114400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g24070
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g24070
>Glyma05g24070.2   sequence type=CDS   gene model=Glyma05g24070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCCAGCCTTGGAAGCCAAACAAGTTGTTCTTCCACAAGAGGGAGAAACTACTGTGGCACCGAACAACTTCTTGAACAGTGTTGTCAATGATGCCACACACAGATCCAAAGTCACTGTTATTGGAAGTGGCAACTGGGGCAGTGTTGCTGCTAAGCTCATTGCCTCCAACACCCTCAGGCTTAGCTCCTTCCATGATGAAGTGAGGATGTGGGTATATGAGGAGACATTACGAAGTGGTGAGCAGCTCACAGATGTCATCAATCGAACCAATGAAAATGTCAAATATCTTCCTGGAATCAAGCTTGGCAAAAATGTTGTTGCAGATCCAGACCTTGAAAGTGCAGTGAAGGATTCCAACATGTTAGTGTTTGTGACTCCACATCAATTTATGGAAGGAATATGCAAAAGGCTTGTTGGGAAAATAAGGGAAGATTCTGAGGCTATTTCCCTTGTTAAAGGGATGGAGCATCTGGGAATCAATTGTTCTGTTTTAATGGGTGCCAACATAGCAAATGAGATAGCTGTGGAGAAGTTTAGTGAAGCAACTGTTGGATACAGGCTCAATAGAGAAGTTGCTGAGAGATGGGTTCAGTTGTTTTATACTCACTATTTCATTGTGACAGCTGTTCAGGATGTTGAAGGAGTTGAACTGTGTGGAACTTTGAAAAATGTTGTGGCCATAGCAGCAGGTTTTGTCGATGGCCTGGAGATGGGAAATAATACAAAAGCTGCAATCATGAGACTTGGTCTTAGAGAAATGAAGGCATTTTCAAAGTTGTTGTTTCCATCTGTTAAGGACAGCACTTTTTTTGAGAGCTGTGGTGTAGCTGACCTTATCACAACATGCTTGGGTGGAAGAAACAGGAAAGTTGCTGAGGCTTATGCAAGGAATGGAGGGAAGAGGTCTTTTGATGAGGTTGAAGCAGAAATGCTACAAGGCCAGAAATTGCAGGGTGTCTCAACTGCGAGTGAGGTTTATGAGGTTCTAAGCCATCGCGGGTGGCTAGAGTTGTTCCCTCTCTTCTCAACAGTGCATGAGATAAGCACTGGCCTACTTCCACCATCAGCAATAGTTGAATACAGTGAGAAGCTACCCAAATCCTTCTAA
Predicted protein sequences of Glyma05g24070
>Glyma05g24070.2   sequence type=predicted peptide   gene model=Glyma05g24070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAPALEAKQVVLPQEGETTVAPNNFLNSVVNDATHRSKVTVIGSGNWGSVAAKLIASNTLRLSSFHDEVRMWVYEETLRSGEQLTDVINRTNENVKYLPGIKLGKNVVADPDLESAVKDSNMLVFVTPHQFMEGICKRLVGKIREDSEAISLVKGMEHLGINCSVLMGANIANEIAVEKFSEATVGYRLNREVAERWVQLFYTHYFIVTAVQDVEGVELCGTLKNVVAIAAGFVDGLEMGNNTKAAIMRLGLREMKAFSKLLFPSVKDSTFFESCGVADLITTCLGGRNRKVAEAYARNGGKRSFDEVEAEMLQGQKLQGVSTASEVYEVLSHRGWLELFPLFSTVHEISTGLLPPSAIVEYSEKLPKSF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo