SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma05g21220

Feature Type:gene_model
Chromosome:Gm05
Start:25744986
stop:25746795
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G37260AT Annotation by Michelle Graham. TAIR10: myb domain protein 73 | chr4:17540602-17541564 FORWARD LENGTH=320 SoyBaseE_val: 1.00E-91ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PTHR10641Panther MYB-RELATED JGI ISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
UniRef100_Q0PJL4UniRef Annotation by Michelle Graham. Most informative UniRef hit: MYB transcription factor MYB61 n=1 Tax=Glycine max RepID=Q0PJL4_SOYBN SoyBaseE_val: 1.00E-161ISS
UniRef100_UPI000189D427UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000189D427 related cluster n=1 Tax=unknown RepID=UPI000189D427 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g098200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g21220.1   sequence type=CDS   gene model=Glyma05g21220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATAGCCGTGGCCCGAAAGGACATGGACCGGATCAAGGGCCCGTGGAGCCCGGAGGAGGACGAGGCCCTTCAGAAGCTTGTGGAGCGGCACGGGCCCAGAAACTGGTCGCTCATCAGCAGGTCCATTCCGGGCCGGTCTGGGAAGTCATGCAGGCTTCGGTGGTGCAACCAGCTGTCGCCCCAGGTCGAGCACCGGGCCTTCACACCGGAAGAGGACGAGACCATTATTCGGGCCCATGCCCGGTTTGGTAACAAGTGGGCCACCATTGCGCGCCTCCTCTCGGGCCGCACCGATAACGCCATCAAGAATCACTGGAACTCAACCCTAAAACGCAAGTGCGCGTCCTTCATGATGGCGGGTGATGAAGCCGTCGCCGTGAGTCCGAGGCCGCTCAAGCGATCCTTCAGCGCCGGCGCGGCGGTGCCTCCTCCCGGAAGCCCCTCCGGATCCGATTTCAGCGAGTCCAGCGCTCCCGGCGTGGTCTCGGTCTCTCCTTCGCACGTGTTTCGCCCCGTGCCGGTTCGGCCGATTGTTGAAACGGCGTCGTCGCAAGACGATGCCGACGATGCCGGACCCGCGACTTCGCTGTCGCTGTCTCTTCCCGGTGTGGAGTCGGCGGAAATTTCAAATCGCGCAACTACGGTGCCGGTGATGCCGGTGAATACCGTTGCGGCTCCGGCACCGGTTCCGGCGGAGGTTGGATTGGGAGCGTTGAATTTGAGTGGAGAGTTTATGGCGGTGATGCATGAGATGATAAGGAAGGAGGTGAGGAGTTACATGGAGCAGCAGAAGAATGGGATGATGTGTTTTCAGGGTATGGAAATGATGGAAGGGTTTAGGAACGTGTCGGTGAAGCGAATTGGGATTAGCAGGGTGGATTCGTAA

>Glyma05g21220.1   sequence type=predicted peptide   gene model=Glyma05g21220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIAVARKDMDRIKGPWSPEEDEALQKLVERHGPRNWSLISRSIPGRSGKSCRLRWCNQLSPQVEHRAFTPEEDETIIRAHARFGNKWATIARLLSGRTDNAIKNHWNSTLKRKCASFMMAGDEAVAVSPRPLKRSFSAGAAVPPPGSPSGSDFSESSAPGVVSVSPSHVFRPVPVRPIVETASSQDDADDAGPATSLSLSLPGVESAEISNRATTVPVMPVNTVAAPAPVPAEVGLGALNLSGEFMAVMHEMIRKEVRSYMEQQKNGMMCFQGMEMMEGFRNVSVKRIGISRVDS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo