SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g20930

Feature Type:gene_model
Chromosome:Gm05
Start:25133360
stop:25136344
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g20930
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G47128AT Annotation by Michelle Graham. TAIR10: Granulin repeat cysteine protease family protein | chr1:17283139-17285609 REVERSE LENGTH=462 SoyBaseE_val: 1.00E-157ISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0015996GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll catabolic process SoyBaseN/AISS
GO:0042744GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008233GO-mf Annotation by Michelle Graham. GO Molecular Function: peptidase activity SoyBaseN/AISS
GO:0008234GO-mf Annotation by Michelle Graham. GO Molecular Function: cysteine-type peptidase activity SoyBaseN/AISS
KOG1543 KOG Cysteine proteinase Cathepsin L JGI ISS
PTHR12411Panther CYSTEINE PROTEASE FAMILY C1-RELATED JGI ISS
PTHR12411:SF44Panther CATHEPSIN L-RELATED JGI ISS
PF00112PFAM Papain family cysteine protease JGI ISS
PF08246PFAM Cathepsin propeptide inhibitor domain (I29) JGI ISS
UniRef100_I1K268UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K268_SOYBN SoyBaseE_val: 0ISS
UniRef100_O24321UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cysteine proteinase n=1 Tax=Phaseolus vulgaris RepID=O24321_PHAVU SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g20930
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g20930
ParalogEvidenceComments
Glyma17g18440 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g20930 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g096800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g20930
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g20930
>Glyma05g20930.1   sequence type=CDS   gene model=Glyma05g20930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCAATGACCATGATATACACCTTACTCTTTCTTTCTTTCACTTTGTCATATGCTATTAAGACCTCCACCATCATCAACTACACCGACAATGAGGTCATGGCCATGTACGAGGAGTGGTTGGTGAAGCACCAAAAGGTGTACAATGAGTTGGGAAAGAAGGACAAGAGATTCCAAGTTTTCAAGGACAACTTAGGGTTCATACAAGAGCACAACAACAATCTAAACAACACTTACAAACTTGGGTTGAACAAGTTTGCTGACATGACCAATGAGGAATACCGTGCCATGTATTTGGGCACCAAGAGTAATGCCAAGCGCAGACTCATGAAAACCAAGAGCACCGGTCACCGCTACGCGTTCAGCGCCCGTGACCGGTTGCCGGTGCATGTGGACTGGAGGATGAAAGGTGCAGTTGCTCCCATCAAAGATCAGGGAAGTTGTGGAAGTTGTTGGGCGTTCTCAACGGTGGCCACAGTGGAAGCGATAAACAAGATAGTGACAGGGAAGTTTGTGTCCTTATCTGAACAAGAACTTGTGGACTGTGACAGAGCCTACAATGAAGGATGCAATGGTGGCCTTATGGACTATGCATTCGAATTCATCATTCAAAATGGTGGCATTGATACTGACAAAGATTACCCATACCGGGGCTTTGATGGCATCTGTGATCCAACTAAGAAAAATGCTAAGGTAGTGAATATTGATGGGTACGAGGATGTTCCACCATATGATGAGAATGCCTTAAAGAAAGCTGTGGCTCATCAACCTGTAAGCGTTGCTATTGAAGCCTCTGGCAGGGCTTTGCAACTTTATCAATCGGGTGTGTTTACTGGTAAATGTGGGACAAGTTTAGACCATGGTGTAGTGGTTGTTGGATATGGCTCTGAAAATGGTGTGGATTACTGGCTGGTGAGGAATTCATGGGGCACTGGATGGGGTGAGGATGGCTATTTCAAGATGCAGCGCAACGTGAGAACCTCCACGGGCAAGTGTGGAATTACAATGGAGGCCTCCTACCCTGTGAAGAATGGTCTAAACTCTGCAGTTCCTAATTCAGTTTATGAAAGCACTGAGGTGTATGTTAGCAGTGCTTGA
Predicted protein sequences of Glyma05g20930
>Glyma05g20930.1   sequence type=predicted peptide   gene model=Glyma05g20930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASMTMIYTLLFLSFTLSYAIKTSTIINYTDNEVMAMYEEWLVKHQKVYNELGKKDKRFQVFKDNLGFIQEHNNNLNNTYKLGLNKFADMTNEEYRAMYLGTKSNAKRRLMKTKSTGHRYAFSARDRLPVHVDWRMKGAVAPIKDQGSCGSCWAFSTVATVEAINKIVTGKFVSLSEQELVDCDRAYNEGCNGGLMDYAFEFIIQNGGIDTDKDYPYRGFDGICDPTKKNAKVVNIDGYEDVPPYDENALKKAVAHQPVSVAIEASGRALQLYQSGVFTGKCGTSLDHGVVVVGYGSENGVDYWLVRNSWGTGWGEDGYFKMQRNVRTSTGKCGITMEASYPVKNGLNSAVPNSVYESTEVYVSSA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo