SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g20910): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g20910): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g20910

Feature Type:gene_model
Chromosome:Gm05
Start:25105339
stop:25106943
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G36890AT Annotation by Michelle Graham. TAIR10: Nucleotide-diphospho-sugar transferases superfamily protein | chr4:17379631-17381627 REVERSE LENGTH=525 SoyBaseE_val: 4.00E-94ISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010154GO-bp Annotation by Michelle Graham. GO Biological Process: fruit development SoyBaseN/AISS
GO:0010417GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan biosynthetic process SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0048367GO-bp Annotation by Michelle Graham. GO Biological Process: shoot development SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005768GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005802GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0015018GO-mf Annotation by Michelle Graham. GO Molecular Function: galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity SoyBaseN/AISS
GO:0016757GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups SoyBaseN/AISS
GO:0042285GO-mf Annotation by Michelle Graham. GO Molecular Function: xylosyltransferase activity SoyBaseN/AISS
KOG1476 KOG Beta-1,3-glucuronyltransferase B3GAT1/SQV-8 JGI ISS
PTHR10896Panther BETA-1,3-GLUCURONYLTRANSFERASE JGI ISS
PTHR10896:SF1Panther BETA-1,3-GLUCURONYLTRANSFERASE-RELATED JGI ISS
PF03360PFAM Glycosyltransferase family 43 JGI ISS
UniRef100_D7MKR9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycosyl transferase family 43 protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MKR9_ARALL SoyBaseE_val: 2.00E-125ISS
UniRef100_UPI000233A269UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A269 related cluster n=1 Tax=unknown RepID=UPI000233A269 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g20910 not represented in the dataset

Glyma05g20910 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma17g18450 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g096600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g20910.2   sequence type=CDS   gene model=Glyma05g20910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCTACCTCAACCGCCGGAGCAACAGCTTCAGAGGATCGCTGCCGTTGGACTCCTCCGGCGAGCACCTTTTGGCTCCTCCTCCAAGCTGCGTGCTGCATCGTCAGCGTCGTCATCGGCTTCCGCTTCTCCCGTCTCGTCTTCCTCTTCCTCTTCTCCGCCGCCTCCCTCGGCGGCGAAATCTCCGCTCTGCTCGTCGTGCATTCAGCCCTCGCCACCGCGAGCCCGATCGCGAAGAGCGTGTCCGCCGCGTGTCCTCCGGCGAATCGGACCGCCGCCGGAAGCCGCGTGGTGGTCGGGCGGCACGGGATCCGTGTCCGGCCGTGGCCGCATCCGAATCCGGAGGAGGTGATGAGGGCACACCGCATAATCGAGAGAATCCAGAGGGAGCAGAGGATGCTGTTCGGAGTGAAAAAGCCGAAAATGGTTATTGCGGTCACGCCGACGCAGGTGCGCACGTTCCAGAAGCTTCACTTGAGCAGCGTCATGCACTCGCTCATGCTCGTGCCGTATGACGTCGTTTGGATCGTGGTGGAGGCCGGAAGAGTCACCAATGAGACCGCTTCCATTATAGCCAAGTCAGGGCTCAGAACCATCCACGTTGGCTTCAATCACCGAATGACGATTTCGTGGAGTGATAGACACAAATTGGAGGCTATGATGCGCCTTCATGCTTTGAGGATAGTGAGAAAAGAGAGACTTGATGGAATTGTGATATTTGCGGATGATAGCAATATGCATAGGTGCAGTTTCTGTTGGAATTCTTGTTCATTCAGGAAGCTTGAGTGGGCTGGGTTTGTGTTGAATTCCAAGTTGCTTTGGAAGGATCTTGATGATAAGCCGGAGTGGATTAAGGATCTTGAAGTGTTCGATGGGGTTGATGATATAGAGAGTCCACTGTATCTGCTCGGGGACACTTCTGTGGTTGAACCACTTGGAAGTTGTGGCCGCCAGGTTTTGCTTTGGTGGCTGCGGGTTGAAGCTCGCACAGACAGCAAATTCCCTGCTCAGTGA

>Glyma05g20910.2   sequence type=predicted peptide   gene model=Glyma05g20910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATSTAGATASEDRCRWTPPASTFWLLLQAACCIVSVVIGFRFSRLVFLFLFSAASLGGEISALLVVHSALATASPIAKSVSAACPPANRTAAGSRVVVGRHGIRVRPWPHPNPEEVMRAHRIIERIQREQRMLFGVKKPKMVIAVTPTQVRTFQKLHLSSVMHSLMLVPYDVVWIVVEAGRVTNETASIIAKSGLRTIHVGFNHRMTISWSDRHKLEAMMRLHALRIVRKERLDGIVIFADDSNMHRCSFCWNSCSFRKLEWAGFVLNSKLLWKDLDDKPEWIKDLEVFDGVDDIESPLYLLGDTSVVEPLGSCGRQVLLWWLRVEARTDSKFPAQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo