Glyma05g15533 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g15533): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g15533): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g15533

Feature Type:	gene_model
Chromosome:	Gm05
Start:	17286927
stop:	17288293
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g15533

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G69490	AT	Annotation by Michelle Graham. TAIR10: NAC-like, activated by AP3/PI \| chr1:26122233-26123222 FORWARD LENGTH=268	SoyBase	E_val: 9.00E-72	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007275	GO-bp	Annotation by Michelle Graham. GO Biological Process: multicellular organismal development	SoyBase	N/A	ISS
GO:0009617	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to bacterium	SoyBase	N/A	ISS
GO:0009825	GO-bp	Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth	SoyBase	N/A	ISS
GO:0009908	GO-bp	Annotation by Michelle Graham. GO Biological Process: flower development	SoyBase	N/A	ISS
GO:0010150	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf senescence	SoyBase	N/A	ISS
GO:0045087	GO-bp	Annotation by Michelle Graham. GO Biological Process: innate immune response	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
PF02365	PFAM	No apical meristem (NAM) protein	JGI		ISS
UniRef100_G7L2R0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: NAC domain transcription factor n=1 Tax=Medicago truncatula RepID=G7L2R0_MEDTR	SoyBase	E_val: 2.00E-92	ISS
UniRef100_UPI000233958B	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233958B related cluster n=1 Tax=unknown RepID=UPI000233958B	SoyBase	E_val: 1.00E-110	ISS

Expression Patterns of Glyma05g15533

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g15533 not represented in the dataset	Glyma05g15533 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma05g15533 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g086000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g15533

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g15533

Limit To All Plant Sequences

>Glyma05g15533.1   sequence type=CDS   gene model=Glyma05g15533   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATAAAGATGCTAATTCAAAAATCCAACTCCCTCCTGGATTTAGATTCCACCCTTCTGATGAGGAGCTAATTGTTCACTATCTGAGAAACAAAGTGACATCATCACCCTTTCCTACTTCATTCATAGCAGAAATAGATCTTTACAACTATAATCCATGGGAGCTCCCAAGCAAAGCTTTGTTTAGGGAGGATGAGTGGTATTTCTTTACTCCTAGAGACAGGAAGTATCCCAATGGAGTGAGGCCTAATAGAGCAGCTGCTTCTGGTTATTGGAAGGCTATTGGGACTGACAAACCCATTTTCACTTCCTGTGGGATAAAGAGCATTGTTGTCAAGAAGGCACTCGTGTTCTACAAGGGTCGTCCACCAAAGGGATCGAAAACCGATTGGATCATGCATGAGTATAGATTGCATGATTCCACAATCTCCAATTCCAAGCAAGGAGGGTCCATGAGAGTAGGCCAATTTCATGAAGACTTACAAAGAATGTATTATATTGATAAAAAGAACTATTTCCAACAACCTTACAACAAAGAGTCGCGAAGCATACCTTCGATGGAGAAAAACAAAGCGCGAACAAGAACCTTCGATGGAGAACAACAGAGTGCAAAGAACAACCTTAGATGGAGAACAACAATCGTCATTAGGTTGCAGAAACAAACATTTTAA

Predicted protein sequences of Glyma05g15533

Limit To All Plant Sequences

>Glyma05g15533.1   sequence type=predicted peptide   gene model=Glyma05g15533   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDKDANSKIQLPPGFRFHPSDEELIVHYLRNKVTSSPFPTSFIAEIDLYNYNPWELPSKALFREDEWYFFTPRDRKYPNGVRPNRAAASGYWKAIGTDKPIFTSCGIKSIVVKKALVFYKGRPPKGSKTDWIMHEYRLHDSTISNSKQGGSMRVGQFHEDLQRMYYIDKKNYFQQPYNKESRSIPSMEKNKARTRTFDGEQQSAKNNLRWRTTIVIRLQKQTF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain