SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g15210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g15210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g15210

Feature Type:gene_model
Chromosome:Gm05
Start:16586228
stop:16600557
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G14250AT Annotation by Michelle Graham. TAIR10: Proteasome component (PCI) domain protein | chr5:4597970-4600561 FORWARD LENGTH=429 SoyBaseE_val: 0ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051604GO-bp Annotation by Michelle Graham. GO Biological Process: protein maturation SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0008180GO-cc Annotation by Michelle Graham. GO Cellular Compartment: signalosome SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG2582 KOG COP9 signalosome, subunit CSN3 JGI ISS
PTHR10758Panther 26S PROTEASOME REGULATORY SUBUNIT S3 JGI ISS
PTHR10758:SF1Panther 26S PROTEASOME REGULATORY SUBUNIT S3 JGI ISS
PF01399PFAM PCI domain JGI ISS
UniRef100_G7KNL3UniRef Annotation by Michelle Graham. Most informative UniRef hit: COP9 signalosome complex subunit n=1 Tax=Medicago truncatula RepID=G7KNL3_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1K1Z8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K1Z8_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g15210 not represented in the dataset

Glyma05g15210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma19g22450 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g075400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g15210.1   sequence type=CDS   gene model=Glyma05g15210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACCCTCTCGAAGCTTTGGTCGCCCAAATCCAAGGGCTATCGAGCTCTCCCGGCGACCTCACTCGCCTCCACACTGTTCTAAAGCAAGCCGATGACTCGCTTCGATCCGAGTCAACTCGCCTCGCTCCGATTCTCACACAGCTCGACCCCTCCATTCACTCCCTCGGGTTTCTCTACATCCTAGAAGCTTCCATGACCGGTCCGGTTACCAAAACGCAGGCTGAGGTCGTCGTTCCGATCGTTACTAGGTTTATCGGCGCTTGCAGCACGGAGCAGATTCGTTTGGCGCCTGATAAATTTTTATCTGTCTGTAAGAGGTTGAAGGATCAAGTGATGCTGTTGGAAGCTCCAATACGGGGCGTGGCTCCCTTGTTCAATGCTCTTCGGAAACTTCAGGCCTCCGCAGAACACTTGACTCCGCTACACTCAGAGTTTCTTCTTCTGTGCTTGTTAGCAAAGTGCTACAAAACTGGTCTATCCATATTGGATGATGATGTTTTTGAAGTAGACCAACCGCGAGACCTTTTTCTCTACTGTTATTATGGAGGTATGATATGCATTGGACAGAAGCGCTTTCAGAAGGCATTGGACCTTCTGCATAATGTTGTAACTGCTCCCATGTCTACCATAAATGCTATAGCTGTTGAAGCTTACAAAAAGTATATATTGGTTTCTCTCATTCGTCATGGACAGTTCTCTACCAGTCTTCCTAAGTATTCTTCTTCAACTGCTCAAAGGAACCTAAAGAACTTTTGTCAGCCTTATGTCGAATTGGCAAATAGTTATGGCACTGGCAAAATTGCAGAACTAGAGGCATATGTCAAGGCAAACGCAGAAAAGTTTGAATCTGACAACAACCTTGGACTGGTTAAGCAGGTTGTATCATCCATGTATAAGCGGAACATTCAGAGATTGACCCAGACATACTTGACCCTTTCTCTCCAAGATATAGCCAACACAGTGCAGTTAAATAGCCCCAAAGAAGCTGAAATGCATGTGCTACAAATGATTCAGGATGGCGAGATATACGCAACTATCAACCAGAAGGACGGAATGGTTAGATTCTTGGAGGATCCTGAACAGTATAAAACCTGTGAAATGATTGAACATATTGATTCATCAATTCAAAGAATAATGGCTCTCTCAAGGAAACTTACTGCAACGGATGAACAAATTTCATGTGATCAGTTGTATTTGTCTAAGGCTGGAAGAGAGAGACAAAGATATGACTTTGATGATTTCGATGTTCCACAAAAGTTCAACGTTTAA

>Glyma05g15210.1   sequence type=predicted peptide   gene model=Glyma05g15210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDPLEALVAQIQGLSSSPGDLTRLHTVLKQADDSLRSESTRLAPILTQLDPSIHSLGFLYILEASMTGPVTKTQAEVVVPIVTRFIGACSTEQIRLAPDKFLSVCKRLKDQVMLLEAPIRGVAPLFNALRKLQASAEHLTPLHSEFLLLCLLAKCYKTGLSILDDDVFEVDQPRDLFLYCYYGGMICIGQKRFQKALDLLHNVVTAPMSTINAIAVEAYKKYILVSLIRHGQFSTSLPKYSSSTAQRNLKNFCQPYVELANSYGTGKIAELEAYVKANAEKFESDNNLGLVKQVVSSMYKRNIQRLTQTYLTLSLQDIANTVQLNSPKEAEMHVLQMIQDGEIYATINQKDGMVRFLEDPEQYKTCEMIEHIDSSIQRIMALSRKLTATDEQISCDQLYLSKAGRERQRYDFDDFDVPQKFNV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo