SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G01810 | AT | Annotation by Michelle Graham. TAIR10: FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: nucleolar protein gar2-related (TAIR:AT2G42320.2). | chr3:289218-292557 FORWARD LENGTH=921 | SoyBase | E_val: 3.00E-36 | ISS |
| GO:0000272 | GO-bp | Annotation by Michelle Graham. GO Biological Process: polysaccharide catabolic process | SoyBase | N/A | ISS |
| GO:0005982 | GO-bp | Annotation by Michelle Graham. GO Biological Process: starch metabolic process | SoyBase | N/A | ISS |
| GO:0008150 | GO-bp | Annotation by Michelle Graham. GO Biological Process: biological process | SoyBase | N/A | ISS |
| GO:0009664 | GO-bp | Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization | SoyBase | N/A | ISS |
| GO:0010075 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0003674 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: molecular function | SoyBase | N/A | ISS |
| UniRef100_Q9SGJ0 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: F28J7.14 protein n=1 Tax=Arabidopsis thaliana RepID=Q9SGJ0_ARATH | SoyBase | E_val: 2.00E-33 | ISS |
| UniRef100_UPI000233EBCC | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI000233EBCC related cluster n=1 Tax=unknown RepID=UPI000233EBCC | SoyBase | E_val: 1.00E-71 | ISS |
|
Glyma05g15115 not represented in the dataset |
Glyma05g15115 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma19g22320 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma05g15115.1 sequence type=CDS gene model=Glyma05g15115 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTTTAATGCAACACTTATCAAGAAGATTCTAGACAACATTGTCTCGGATGAGCTTTGCCCTGATCCTGTTCCCTCTAATGTTTTTGAAGCTTTGGACTCAGAGAATGAAATGGAAGATGGAAAGGAGTGTGTCAACAGCTTTCCATGCATTGCAGCTACCATAGCCTATTCACCACCAGCAGCAACTTCCATTGCAAGCATTGTTGGGGAGATGGGAAACAAATCTCAACTAAGAAGAAACAAATCTTCTGTTGTTAGGAAGTCGCACACAAGTGATGATGAGCTCGATGAATTGATGTCTCCATTGTCTTCAATATTCTTCAGTGCTTCCTCATCCCCAAAAGTTTCAACAAACTCCAGCTTGAAGTTGAAAGAAATTCGCAACCAATCTCCTGTCAGATATGAACTCCTTAGGGAGGTGTGGATGAACTGCGAGTAG
>Glyma05g15115.1 sequence type=predicted peptide gene model=Glyma05g15115 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MFNATLIKKILDNIVSDELCPDPVPSNVFEALDSENEMEDGKECVNSFPCIAATIAYSPPAATSIASIVGEMGNKSQLRRNKSSVVRKSHTSDDELDELMSPLSSIFFSASSSPKVSTNSSLKLKEIRNQSPVRYELLREVWMNCE*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
