SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g14680

Feature Type:gene_model
Chromosome:Gm05
Start:15799689
stop:15801485
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g14680
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G28980AT Annotation by Michelle Graham. TAIR10: CDK-activating kinase 1AT | chr4:14288471-14290102 FORWARD LENGTH=479 SoyBaseE_val: 2.00E-26ISS
GO:0000079GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0000278GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic cell cycle SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0010078GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of root meristem identity SoyBaseN/AISS
GO:0010440GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal lineage progression SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0045736GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004713GO-mf Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
GO:0019912GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclin-dependent protein kinase activating kinase activity SoyBaseN/AISS
PTHR24056Panther CELL DIVISION PROTEIN KINASE JGI ISS
PTHR24056:SF88Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_G7L878UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein kinase n=1 Tax=Medicago truncatula RepID=G7L878_MEDTR SoyBaseE_val: 1.00E-25ISS
UniRef100_I1K5W1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1K5W1_SOYBN SoyBaseE_val: 2.00E-32ISS

Expression Patterns of Glyma05g14680
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma05g14680 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma05g14680
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g14680
>Glyma05g14680.1   sequence type=CDS   gene model=Glyma05g14680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTACCTCAAAGAAAACCGAGAAGGTCAGATTGAGCTTCGTTCTCTACCGAAACCGCGAGACAAACTATGGCAGTTCGTGGTGGCTACTGGTGGTTGTGGGTGGTGAAGAAGAAGCTTGGGACACCAAATTTCGAGAAGATCCAACGGGCTTCCCAGACATTGTCGTTTTGCACAAGTACTTCTGGCGAGAAGACGAGAACACCATCCTTGTCCTTGAGTTCCTCAGAACCAACTTGGCCACCATCATCGTCGACACTGCTAAGCATTGGATGATTCAAATTCTCTTCGGTCTCGATGCCGCTTGCTGCCACATGGTCCTCCACCGAGATTTGAAGCCCTCTAATCTCTTAATTTCCGAATTCGACCTCCTCAAGATCGCTGATTTTGGACAGTGGATCCATTCATTTCCTATGAATTTGAGGTCTCTTACATCATTGCCTCCCTTCTTGGAGTTCCTCAACAAGTCCTTTTCTCTCTCTCTCTCTCTCTCCATCTGGGTGTGTGTGTATTTGTTTTCAATGAGTTTAAAAGTTATGGAATTTTCATGTGATACAGGTATAGGATTCAGCAAAGGAGGACTTCGTGGCAAGATGGTGTTCTTGGCACAAACTGTCCTATTCCTGCAAAGTGGTACTAGACTTACTAGTTTTAGGTGA
Predicted protein sequences of Glyma05g14680
>Glyma05g14680.1   sequence type=predicted peptide   gene model=Glyma05g14680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVTSKKTEKVRLSFVLYRNRETNYGSSWWLLVVVGGEEEAWDTKFREDPTGFPDIVVLHKYFWREDENTILVLEFLRTNLATIIVDTAKHWMIQILFGLDAACCHMVLHRDLKPSNLLISEFDLLKIADFGQWIHSFPMNLRSLTSLPPFLEFLNKSFSLSLSLSIWVCVYLFSMSLKVMEFSCDTGIGFSKGGLRGKMVFLAQTVLFLQSGTRLTSFR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo