|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G08410 | AT | Annotation by Michelle Graham. TAIR10: ferredoxin/thioredoxin reductase subunit A (variable subunit) 2 | chr5:2709974-2710528 REVERSE LENGTH=184 | SoyBase | E_val: 1.00E-33 | ISS |
| GO:0009107 | GO-bp | Annotation by Michelle Graham. GO Biological Process: lipoate biosynthetic process | SoyBase | N/A | ISS |
| GO:0009965 | GO-bp | Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis | SoyBase | N/A | ISS |
| GO:0015979 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photosynthesis | SoyBase | N/A | ISS |
| GO:0019684 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction | SoyBase | N/A | ISS |
| GO:0030154 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell differentiation | SoyBase | N/A | ISS |
| GO:0045893 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0009536 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plastid | SoyBase | N/A | ISS |
| GO:0008937 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ferredoxin-NAD(P) reductase activity | SoyBase | N/A | ISS |
| GO:0016992 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: lipoate synthase activity | SoyBase | N/A | ISS |
| GO:0030385 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ferredoxin:thioredoxin reductase activity | SoyBase | N/A | ISS |
| GO:0051539 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: 4 iron, 4 sulfur cluster binding | SoyBase | N/A | ISS |
| PTHR10949 | Panther | LIPOIC ACID SYNTHETASE | JGI | ISS | |
| PTHR10949:SF1 | Panther | LIPOIC ACID SYNTHETASE | JGI | ISS | |
| PF02941 | PFAM | Ferredoxin thioredoxin reductase variable alpha chain | JGI | ISS | |
| UniRef100_B9RGK8 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Lipoic acid synthetase, putative n=1 Tax=Ricinus communis RepID=B9RGK8_RICCO | SoyBase | E_val: 3.00E-39 | ISS |
| UniRef100_I1K1Q3 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K1Q3_SOYBN | SoyBase | E_val: 9.00E-103 | ISS |
|
Glyma05g09390 not represented in the dataset |
Glyma05g09390 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.05g000300 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma05g09390.1 sequence type=CDS gene model=Glyma05g09390 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGAGCGGCGCCAGCAGCACTATAAGGCTATCGCCGATGGTGAGCGTGTCCCCGAATTGCAATTGCTCATCGATGATGGTGATGAAGAAGACGACGACGGCGGTGGCTCCTTTGTGGATGAAAAGCAAGAGCGCTAGGGGTGGTATTAGGTGCGAGGTGGCTATTAATGCGGTGGATGAGTCGACGACGTCACCGGAGTCGAAGATTGGAGCGCGTGTGAAGGTGAAGGCGGGTGTAAAGGTGTACCACGTCCCCAAAGTAGCCGAGCTTGACCTCACGGGTCTGGAAGGCGAGATCAAGCAGTATGTTGGCCTCTGGAACGGTAAGCGAATCTCCGCCAATCTTCCTTACAAGGTTCAGTTTCTCACCGACATCCCAGCTCGTGGTCCTGTCAAGTTTTTTGCCCACCTCAAGGAAGATGAATTCGACTATCTTTAG
>Glyma05g09390.1 sequence type=predicted peptide gene model=Glyma05g09390 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MSGASSTIRLSPMVSVSPNCNCSSMMVMKKTTTAVAPLWMKSKSARGGIRCEVAINAVDESTTSPESKIGARVKVKAGVKVYHVPKVAELDLTGLEGEIKQYVGLWNGKRISANLPYKVQFLTDIPARGPVKFFAHLKEDEFDYL*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||