SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g09390): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g09390): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g09390

Feature Type:gene_model
Chromosome:Gm05
Start:9096700
stop:9097908
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G08410AT Annotation by Michelle Graham. TAIR10: ferredoxin/thioredoxin reductase subunit A (variable subunit) 2 | chr5:2709974-2710528 REVERSE LENGTH=184 SoyBaseE_val: 1.00E-33ISS
GO:0009107GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate biosynthetic process SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0008937GO-mf Annotation by Michelle Graham. GO Molecular Function: ferredoxin-NAD(P) reductase activity SoyBaseN/AISS
GO:0016992GO-mf Annotation by Michelle Graham. GO Molecular Function: lipoate synthase activity SoyBaseN/AISS
GO:0030385GO-mf Annotation by Michelle Graham. GO Molecular Function: ferredoxin:thioredoxin reductase activity SoyBaseN/AISS
GO:0051539GO-mf Annotation by Michelle Graham. GO Molecular Function: 4 iron, 4 sulfur cluster binding SoyBaseN/AISS
PTHR10949Panther LIPOIC ACID SYNTHETASE JGI ISS
PTHR10949:SF1Panther LIPOIC ACID SYNTHETASE JGI ISS
PF02941PFAM Ferredoxin thioredoxin reductase variable alpha chain JGI ISS
UniRef100_B9RGK8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lipoic acid synthetase, putative n=1 Tax=Ricinus communis RepID=B9RGK8_RICCO SoyBaseE_val: 3.00E-39ISS
UniRef100_I1K1Q3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K1Q3_SOYBN SoyBaseE_val: 9.00E-103ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g09390 not represented in the dataset

Glyma05g09390 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g000300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g09390.1   sequence type=CDS   gene model=Glyma05g09390   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCGGCGCCAGCAGCACTATAAGGCTATCGCCGATGGTGAGCGTGTCCCCGAATTGCAATTGCTCATCGATGATGGTGATGAAGAAGACGACGACGGCGGTGGCTCCTTTGTGGATGAAAAGCAAGAGCGCTAGGGGTGGTATTAGGTGCGAGGTGGCTATTAATGCGGTGGATGAGTCGACGACGTCACCGGAGTCGAAGATTGGAGCGCGTGTGAAGGTGAAGGCGGGTGTAAAGGTGTACCACGTCCCCAAAGTAGCCGAGCTTGACCTCACGGGTCTGGAAGGCGAGATCAAGCAGTATGTTGGCCTCTGGAACGGTAAGCGAATCTCCGCCAATCTTCCTTACAAGGTTCAGTTTCTCACCGACATCCCAGCTCGTGGTCCTGTCAAGTTTTTTGCCCACCTCAAGGAAGATGAATTCGACTATCTTTAG

>Glyma05g09390.1   sequence type=predicted peptide   gene model=Glyma05g09390   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGASSTIRLSPMVSVSPNCNCSSMMVMKKTTTAVAPLWMKSKSARGGIRCEVAINAVDESTTSPESKIGARVKVKAGVKVYHVPKVAELDLTGLEGEIKQYVGLWNGKRISANLPYKVQFLTDIPARGPVKFFAHLKEDEFDYL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo