SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g08120): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g08120): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g08120

Feature Type:gene_model
Chromosome:Gm05
Start:8061106
stop:8068217
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G26900AT Annotation by Michelle Graham. TAIR10: Sodium Bile acid symporter family | chr2:11475156-11477870 REVERSE LENGTH=409 SoyBaseE_val: 0ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0006814GO-bp Annotation by Michelle Graham. GO Biological Process: sodium ion transport SoyBaseN/AISS
GO:0006849GO-bp Annotation by Michelle Graham. GO Biological Process: plasma membrane pyruvate transport SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0035725GO-bp Annotation by Michelle Graham. GO Biological Process: sodium ion transmembrane transport SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0008508GO-mf Annotation by Michelle Graham. GO Molecular Function: bile acid:sodium symporter activity SoyBaseN/AISS
GO:0050833GO-mf Annotation by Michelle Graham. GO Molecular Function: pyruvate transmembrane transporter activity SoyBaseN/AISS
KOG2718 KOG Na+-bile acid cotransporter JGI ISS
PTHR10361Panther SODIUM-BILE ACID COTRANSPORTER RELATED JGI ISS
PTHR10361:SF0Panther BILE ACID:SODIUM SYMPORTER FAMILY PROTEIN JGI ISS
PF01758PFAM Sodium Bile acid symporter family JGI ISS
UniRef100_G7JU57UniRef Annotation by Michelle Graham. Most informative UniRef hit: Bile acid Na+ symporter family protein n=1 Tax=Medicago truncatula RepID=G7JU57_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI0002339C91UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339C91 related cluster n=1 Tax=unknown RepID=UPI0002339C91 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g08120 not represented in the dataset

Glyma05g08120 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma17g12890 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g011700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g08120.2   sequence type=CDS   gene model=Glyma05g08120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTACCATCATCCTCAGAGTAGCAGGGACGTATGATGCACTGCTTAAGCCAAGCTTTCGTACCCCCACTTGGACGAAGCTTCATAATTCCCATCTGGAAGTGAAAGGCCACTCTTATCTGCCTGAGAGTGGAGGAAGCTGTGCAATTCGAAGCATGTTGCGGGGTCCAGTTGCTGTTTTAGAACTTCCCTTAAGCCTTCAAGCGTCCAGAAGAAGGAACTCTCAAATATTTTGCAATGCTACAACAGACATCTCTGGAGATATTCCTGAAAGTGCTGGTGAGCTGAGCCAGTATGAGAAAGTGATTGAAACGTTAACAACTCTGTTTCCTGTGTGGGTCGTCTTGGGGGCCATTGTCGGCATTTACAAACCAACTGCTGTAACGTGGTTGGCGACAGATCTTTTTAGTCTTGGCTTGGGTTTCCTCATGCTCTCTATGGGCTTGACATTGACATTTGAGGATTTCAGACGCTGTCTGCAAAATCCGTGGACTGTGGGTATAGGGTTTCTTGCACAATATTTAATTAAACCCATGCTAGGCTTTGCCATTGCAATGACTCTAAAACTTTCAGCTCCTCTTGCAACTGGTCTTATTTTGGTTGCATGTTGTCCTGGATGTCAGGCATCAAATGTTGCAACATTCATAGCCAAGGGAAATGTTGCACTCTCTGTTCTTATGACAACGTGTTCAACTATTGGAGCTATTATAATGACCCCACTCCTTACAAATCTTCTTGCCGGTCAACTCGTTCCAGTTGATGCTGTTGGCCTGGCACTTAGTACCTTTCAGGTTGTTTTAGTCCCAACGATTGTGGGAGTTTTGGCAAATGAGCTTTTCCCCAAGTTCACTTCAAAGATAATCACGATTACTCCTTTGATAGGAGTCATTTTGACCACTCTACTTTGTGCAAGTCCAATTGGGCTAGCTTCAGATGCATTAAAAGCTCAAGGAGCACAACTAGTATTACCAGTTGTTTTCCTACATGCTGCTTCATTTGCTCTTGGTTATTGGGTTTCAAGAATATCATTTGGTGAATCCACGTCACGCACTATATCTATAGAGTGTGGGATGCAGAGTTCTGCATTTGGATTTTTGCTTGCTCAGAAGCACTTTACAAACCCTCTTGTAGCTGTTCCTTCTGCTGTTAGCGTTGTCTGCATGGCGCTTGGTGGGAGTGCTCTTGCCGTGTTTTGGATGAACAGACCAATTCCCCTTGATGACAAAGATGATTTCAAGGAATGA

>Glyma05g08120.2   sequence type=predicted peptide   gene model=Glyma05g08120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSTIILRVAGTYDALLKPSFRTPTWTKLHNSHLEVKGHSYLPESGGSCAIRSMLRGPVAVLELPLSLQASRRRNSQIFCNATTDISGDIPESAGELSQYEKVIETLTTLFPVWVVLGAIVGIYKPTAVTWLATDLFSLGLGFLMLSMGLTLTFEDFRRCLQNPWTVGIGFLAQYLIKPMLGFAIAMTLKLSAPLATGLILVACCPGCQASNVATFIAKGNVALSVLMTTCSTIGAIIMTPLLTNLLAGQLVPVDAVGLALSTFQVVLVPTIVGVLANELFPKFTSKIITITPLIGVILTTLLCASPIGLASDALKAQGAQLVLPVVFLHAASFALGYWVSRISFGESTSRTISIECGMQSSAFGFLLAQKHFTNPLVAVPSAVSVVCMALGGSALAVFWMNRPIPLDDKDDFKE*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo