SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g08011

Feature Type:gene_model
Chromosome:Gm05
Start:7931327
stop:7935953
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g08011
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G56120AT Annotation by Michelle Graham. TAIR10: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein | chr3:20823243-20826357 FORWARD LENGTH=468 SoyBaseE_val: 2.00E-143ISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0016570GO-bp Annotation by Michelle Graham. GO Biological Process: histone modification SoyBaseN/AISS
GO:0048449GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ formation SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0016740GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity SoyBaseN/AISS
PTHR23245Panther UNCHARACTERIZED JGI ISS
PF02475PFAM Met-10+ like-protein JGI ISS
UniRef100_F6HH45UniRef Annotation by Michelle Graham. Most informative UniRef hit: tRNA (guanine(37)-N1)-methyltransferase 2 n=1 Tax=Vitis vinifera RepID=TRM52_VITVI SoyBaseE_val: 5.00E-147ISS
UniRef100_I1K1A8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K1A8_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g08011
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g08011 not represented in the dataset
Glyma05g08011 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g08011
ParalogEvidenceComments
Glyma17g12985 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g08011 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g012700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g08011
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g08011
>Glyma05g08011.1   sequence type=CDS   gene model=Glyma05g08011   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGGACGAGAGCAAGTTCGAGGTACACTTCAAACTGTGGGCCCTTCGAATCCCTTGCCAACATTATCATGTGCTGAAGCAGATACTGCCTACTGGAGTGGAGAAAAATTATCCAAGAATCAAAACTATTGTTAATAAAGTTGGAACCATTACAAATGAATTTCGTGTGCCAGAGTTTGAAATTTTAGCAGGAGAGCATAATATGATTACAGAAGTGAAGCAATATGGTGCCACTTTTAGGCTTGATTACAGCTTGGTTTATTGGAATTCGAGATTGGAACATGAACACAAAAGGTTAGTCTCAATGTTCCAAGCTGGAGAGACCATTTGTGACATGTTTGCTGGTATTGGTCCTTTTGCCATTCCTGCAGCACAGAAAGGATGCATAGTCTATGCAAATGATTTAAATCCTGATAGCATTCACTATCTGAGGATTAATGCCAAAATCAATAAGGTTGGTGATTGCATTTATGCATACAACATGGATGCTAGAAAATTCATCTCCCAGATGATGGAAGTGCCAAATACTGAGGTCACATTAGAAAACTCACATGAAGTCCCTATTTTGGATACACGAGACAATGCTGAATCAAATTCTAAAAATGAGTTGCTAACTGGGAATGGAGAGGCTCATGGAACTGACATCCTTGAAGGTGGTAGGAGAAAAGGAAGCGCAAACAAAAGAATGAGAGGCTCTGAAATCTCTGTCACAAAAACTTGGGAACATGTTGATCATGTAATAATGAACCTACCTGCATCTGCTGTTCAGTTTCTAGATGCATTCAGGGGATTAATCCAGAAGAAATATTGGAAAGGATGTCTACCATGGATTCACTGCTATTGCTTCATTAGGGCAACTGAAACTCCTGAGACTATAATAGCTGTAGCAGAATCTGCTTTAGACGCTCATATACAAGACTCAAGATTTCATAGGGTTAGGGATGTGGCTCCAAACAAGGCAATGTTTTGTTTAAGCTTCAGGTTGCCAGAAGCATGCCTTAAAGAAGATTGTCCATAA
Predicted protein sequences of Glyma05g08011
>Glyma05g08011.1   sequence type=predicted peptide   gene model=Glyma05g08011   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLDESKFEVHFKLWALRIPCQHYHVLKQILPTGVEKNYPRIKTIVNKVGTITNEFRVPEFEILAGEHNMITEVKQYGATFRLDYSLVYWNSRLEHEHKRLVSMFQAGETICDMFAGIGPFAIPAAQKGCIVYANDLNPDSIHYLRINAKINKVGDCIYAYNMDARKFISQMMEVPNTEVTLENSHEVPILDTRDNAESNSKNELLTGNGEAHGTDILEGGRRKGSANKRMRGSEISVTKTWEHVDHVIMNLPASAVQFLDAFRGLIQKKYWKGCLPWIHCYCFIRATETPETIIAVAESALDAHIQDSRFHRVRDVAPNKAMFCLSFRLPEACLKEDCP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo