SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g05450): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g05450): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g05450

Feature Type:gene_model
Chromosome:Gm05
Start:4764601
stop:4766698
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g05450
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G17600AT Annotation by Michelle Graham. TAIR10: Chlorophyll A-B binding family protein | chr4:9803759-9804714 FORWARD LENGTH=262 SoyBaseE_val: 4.00E-100ISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006417GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of translation SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
UniRef100_B9SEE4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor, putative n=1 Tax=Ricinus communis RepID=B9SEE4_RICCO SoyBaseE_val: 3.00E-114ISS
UniRef100_I1K0W3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K0W3_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g05450
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g05450 not represented in the dataset
Glyma05g05450 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g05450
ParalogEvidenceComments
Glyma17g15730 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g05450 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g066100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g05450
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g05450
>Glyma05g05450.1   sequence type=CDS   gene model=Glyma05g05450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAAATGCAAAGCATGTCAACCACCATGGCTTCGTTTTCTCCTCCGACCCATTTCTCAGCCACTCCTTCTTCCTCGAAACCCCGTCTTGTCTACAAGAACAACTTTTTCTTCTCTCTCAGGTCGAGGAGTCTTTCTCTCTCTCCCTTGAAGGCTGCTGCTTCTGAGAACGGCGTCGGGACCGCCGTGGAGCCTCCGCCGGAGCAGGCCGTGCCGGTGCCGGAGCCTTCTCTGCCTCCGGTGGACAATAGTTCTGTGGGGACCAATGGGTCTGCTGTTGCGGTTGAGAGTGAGGTGGTTAAGGTTCAAAGTAGTTTCGTGGATCCGAGGTGGGTTGCAGGAACATGGGATTTGAAGCAGTTTCAGAAAAATGGAACCACCGATTGGGATGCTGTTATTGATGCTGAGGCTAGAAGGAGAAAATGGCTCGAGGATAACCCGGAATCATCCAGCAATGAAAATCCTGTAGTTTTTGACACCTCCATCGTACCTTGGTGGGCATGGATGAAAAGGTTCCATCTCCCTGAAGCTGAACTACTCAATGGCCGTGCTGCGATGATAGGGTTCTTTATGGCGTATTTTGTTGATAGTTTGACAGGAGTAGGTCTAGTTGATCAAATGAGCAACTTCTTTTGCAAAACTCTGCTGTTCGTAGCAGTGTTGGGAGTACTTCTGATCCGAAAGAACGAGGACCTTGAAAACCTTAAGAAGCTATTTGATGAGACTACATTATATGACAAGCAATGGCAAGCAACTTGGCAGGATGAGAATTCAAGCACTTCCAAAAATGAGTAG
Predicted protein sequences of Glyma05g05450
>Glyma05g05450.1   sequence type=predicted peptide   gene model=Glyma05g05450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQMQSMSTTMASFSPPTHFSATPSSSKPRLVYKNNFFFSLRSRSLSLSPLKAAASENGVGTAVEPPPEQAVPVPEPSLPPVDNSSVGTNGSAVAVESEVVKVQSSFVDPRWVAGTWDLKQFQKNGTTDWDAVIDAEARRRKWLEDNPESSSNENPVVFDTSIVPWWAWMKRFHLPEAELLNGRAAMIGFFMAYFVDSLTGVGLVDQMSNFFCKTLLFVAVLGVLLIRKNEDLENLKKLFDETTLYDKQWQATWQDENSSTSKNE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo