SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g05270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g05270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g05270

Feature Type:gene_model
Chromosome:Gm05
Start:4599317
stop:4602670
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G17550AT Annotation by Michelle Graham. TAIR10: Major facilitator superfamily protein | chr4:9777938-9779738 REVERSE LENGTH=544 SoyBaseE_val: 0ISS
GO:0008643GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate transport SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0055062GO-bp Annotation by Michelle Graham. GO Biological Process: phosphate ion homeostasis SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005351GO-mf Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity SoyBaseN/AISS
KOG2533 KOG Permease of the major facilitator superfamily JGI ISS
PTHR11662Panther PHOSPHATE TRANSPORTER-RELATED JGI ISS
PTHR11662:SF82Panther SUBFAMILY NOT NAMED JGI ISS
PF07690PFAM Major Facilitator Superfamily JGI ISS
UniRef100_B9T0L8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycerol-3-phosphate transporter, putative n=1 Tax=Ricinus communis RepID=B9T0L8_RICCO SoyBaseE_val: 0ISS
UniRef100_UPI000233A296UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A296 related cluster n=1 Tax=unknown RepID=UPI000233A296 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g05270 not represented in the dataset

Glyma05g05270 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma17g15580 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g064500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g05270.1   sequence type=CDS   gene model=Glyma05g05270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTCGGCACTGCGATTGTTGTTGCGGCGGAATCCCACCTGGGATTCTGCTAATACGAGGAAAGCAATGGAACCTCCAGACGCACCGCTACATGGTGCTCCTCACCACCTTCGTCGCCTACGCGTGCTACCACGCGTCAAGAAAACCCACCGGAATAGTCAAGAGCGTCTTATGCCCCGAACACAAAGGAACCTCGCAAGGCTGGAGCCCATTCAACGGTCACGATGGAACGTCGAAGCTGGGCGAAATCGACGTGGCGTTCTTAGCGTGTTACTCTATCGGGATGTACGTGGCGGGGCACTTAGGAGATACCCTCGACCTTCGCTTGTTCCTGGCAACCGGAATGGTCGGTAGCGGGATATTCGTATCACTCTTCGGAATGGGATACTTCTGGAACATACACTCTTTTTTGTTCTACCTTTCAATGCAAATGATTGCTGGCATGTTTCAGGCCACGGGGTGGCCTTCGGTTGTGGCGGTTATCGGTAACTGGTTCGGGAAGAGGAAGAGAGGGCTCATAATGGGGGTGTGGAACGCGCATACCTCGGTGGGTAACATTAGTGGTTCCCTTCTTGCGGCGAGTGTTTTGGAATATGGGTGGGGTTGGTCTTTTGTGGTGCCTGGTGCTTTGATTGTTGGTGGTGGTGTGGTTGTGTATTTGTTTCTGGCTCCTTATCCTGAGGATGTAGGGTTCTCTTGTGTTCATGGTGGTGGTGATGAAGAGGCTCAGGTGAATGATGAGAAAGGTGGTGGTGTTCCTACTAGAGAAGGGTCCGTGAATAGAAAAAGCGTTGGGCTTGTTGAGGCGTGCATGATTCCTGGTGTTATACCTTTTGCGCTGTGCCTTTTCTTCGCCAAGCTTGTTGCCTACACGTTCTTGTATTGGTTACCCTTTTACTTGACTCAGACAGAAATTGGTGGGAAGTATATCTCGGTTAAGTCTGCTGGAAACCTTTCAACCTTGTTCGATGTAGGGGGCATTGTTGGGGGTATTCTTGCTGGCTACGTATCTGATAAACTCAATGCCCGTGCTATAACTGCAGCCAGCTTCATGTATGCAGCAATTCCTTCTATGCTTTTATACCGGCATTATGGAAGTGTTTCTATGAATGCCAACATTGGACTTATGATGGTGACTGGATTATTTGTAAATGGACCTTATGCACTTATCACCACGGCTGTCTCTGCTGACTTGGGTACACATAGTTCTCTCAAAGGAGATTCTCGTGCTCTAGCTACAGTGACTGCCATTATAGATGGTACTGGATCTGTTGGTGCAGCTCTTGGCCCTCTTCTCACTGGGTTCATTTCAACAAGGGGATGGAATGAAGTTTTCATGATGCTAGTTCTTGGTGCTTTTATTGCGGGGCTTCTTTTGTCGCGTTTGATCATAGCAGAAATTGCAGAGAGAAGTGGCAAACCTTTATCAAGTGGACAGCAAAATCCTGAAGCCACTGCATCTCAACCGCTTCTGGAGGAGGATAGGTGA

>Glyma05g05270.1   sequence type=predicted peptide   gene model=Glyma05g05270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSRHCDCCCGGIPPGILLIRGKQWNLQTHRYMVLLTTFVAYACYHASRKPTGIVKSVLCPEHKGTSQGWSPFNGHDGTSKLGEIDVAFLACYSIGMYVAGHLGDTLDLRLFLATGMVGSGIFVSLFGMGYFWNIHSFLFYLSMQMIAGMFQATGWPSVVAVIGNWFGKRKRGLIMGVWNAHTSVGNISGSLLAASVLEYGWGWSFVVPGALIVGGGVVVYLFLAPYPEDVGFSCVHGGGDEEAQVNDEKGGGVPTREGSVNRKSVGLVEACMIPGVIPFALCLFFAKLVAYTFLYWLPFYLTQTEIGGKYISVKSAGNLSTLFDVGGIVGGILAGYVSDKLNARAITAASFMYAAIPSMLLYRHYGSVSMNANIGLMMVTGLFVNGPYALITTAVSADLGTHSSLKGDSRALATVTAIIDGTGSVGAALGPLLTGFISTRGWNEVFMMLVLGAFIAGLLLSRLIIAEIAERSGKPLSSGQQNPEATASQPLLEEDR*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo