SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g03650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g03650): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g03650

Feature Type:gene_model
Chromosome:Gm05
Start:2806268
stop:2812988
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G62990AT Annotation by Michelle Graham. TAIR10: KNOTTED-like homeobox of Arabidopsis thaliana 7 | chr1:23337468-23340348 FORWARD LENGTH=291 SoyBaseE_val: 6.00E-163ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0010089GO-bp Annotation by Michelle Graham. GO Biological Process: xylem development SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0044036GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule metabolic process SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048513GO-bp Annotation by Michelle Graham. GO Biological Process: organ development SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:2000652GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of secondary cell wall biogenesis SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
KOG0773 KOG Transcription factor MEIS1 and related HOX domain proteins JGI ISS
PTHR11850Panther HOMEOBOX PROTEIN JGI ISS
PTHR11850:SF15Panther HOMEOBOX PROTEIN KNOTTED-1 JGI ISS
PF00046PFAM Homeobox domain JGI ISS
PF03789PFAM ELK domain JGI ISS
PF03790PFAM KNOX1 domain JGI ISS
PF03791PFAM KNOX2 domain JGI ISS
UniRef100_B9RC00UniRef Annotation by Michelle Graham. Most informative UniRef hit: Homeobox protein knotted-1, putative n=1 Tax=Ricinus communis RepID=B9RC00_RICCO SoyBaseE_val: 2.00E-180ISS
UniRef100_I1K0E5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K0E5_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g03650 not represented in the dataset

Glyma05g03650 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma17g14180 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g050600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma05g03650.1   sequence type=CDS   gene model=Glyma05g03650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAAGAAGCAGGGTTGGGAATGGGAATGGTGAGCGGAGAAGTGTCCGCCGCCGGCGACCACCATCACCACCACCGTCAAGTGAAGGCGGAGATAGCCACCCATCCACTCTATGAACAGCTTCTGTCTGCACACGTGTCATGCCTCCGCGTGGCCACACCCATCGATCAGTTGCCACTCATCGACGGTCAGTTATCGCAGTCCCACCATCTCCTCCGCTCTTATGCCTCACACCATTCCCATTCCCTCTCGCCCCATGACCGACAAGAACTTGACAACTTCATGGCACAGTATTTGATTGTGTTGTGTACATTTAAAGAGCAGCTTCAGCAACATGTGAGGGTGCATGCCGTGGAGGCTGTGATGGCCTGCCGTGATATTGAAAGTACCTTGCAAGCTCTGACAGGAGTCAGTTTGGGAGAAGGAACAGGTGCAACAATGTCAGATGATGAAGATGATTTGCAGATGGATGGCTCTTTAGACCAGTCTAGCGCTGAGGGACATGACTTAATGGGATTTGGTCCATTGCTTCCTACAGAATCTGAAAGGTCCCTGATGGAAAGAGTTCGTCAGGAGCTTAAGATTGAGCTCAAGCAGGGTTTTAAGTCTAGAATTGAAGATGTTAGGGAGGAAATATTAAGAAAACGGAGAGCTGGGAAATTGCCAGGCGACACAACATCGGTTTTAAAGGCCTGGTGGCAGCAACATGCTAAGTGGCCCTACCCAACTGAAGATGACAAGGCAAAACTTGTGGAGGAGACAGGGTTGCAGCTGAAGCAAATCAATAATTGGTTCATCAATCAAAGGAAACGCAACTGGCACAGCAACTCTCAATCAGTTACCTCTCTGAAGTCCAAGCGCAAGAGAGAGTATGCCCACTAA

>Glyma05g03650.1   sequence type=predicted peptide   gene model=Glyma05g03650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQEAGLGMGMVSGEVSAAGDHHHHHRQVKAEIATHPLYEQLLSAHVSCLRVATPIDQLPLIDGQLSQSHHLLRSYASHHSHSLSPHDRQELDNFMAQYLIVLCTFKEQLQQHVRVHAVEAVMACRDIESTLQALTGVSLGEGTGATMSDDEDDLQMDGSLDQSSAEGHDLMGFGPLLPTESERSLMERVRQELKIELKQGFKSRIEDVREEILRKRRAGKLPGDTTSVLKAWWQQHAKWPYPTEDDKAKLVEETGLQLKQINNWFINQRKRNWHSNSQSVTSLKSKRKREYAH*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo