SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g03120

Feature Type:gene_model
Chromosome:Gm05
Start:2393248
stop:2397573
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g03120
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G63400AT Annotation by Michelle Graham. TAIR10: adenylate kinase 1 | chr5:25393274-25394817 REVERSE LENGTH=246 SoyBaseE_val: 3.00E-148ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006139GO-bp Annotation by Michelle Graham. GO Biological Process: nucleobase-containing compound metabolic process SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009749GO-bp Annotation by Michelle Graham. GO Biological Process: response to glucose stimulus SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0046939GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide phosphorylation SoyBaseN/AISS
GO:0051788GO-bp Annotation by Michelle Graham. GO Biological Process: response to misfolded protein SoyBaseN/AISS
GO:0080129GO-bp Annotation by Michelle Graham. GO Biological Process: proteasome core complex assembly SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0004017GO-mf Annotation by Michelle Graham. GO Molecular Function: adenylate kinase activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016776GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, phosphate group as acceptor SoyBaseN/AISS
GO:0019205GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleobase-containing compound kinase activity SoyBaseN/AISS
KOG3078 KOG Adenylate kinase JGI ISS
PTHR23359Panther ADENYLATE KINASE JGI ISS
PF00406PFAM Adenylate kinase JGI ISS
PF05191PFAM Adenylate kinase, active site lid JGI ISS
UniRef100_C6TBP8UniRef Annotation by Michelle Graham. Best UniRef hit: Adenylate kinase 3 n=1 Tax=Glycine max RepID=C6TBP8_SOYBN SoyBaseE_val: 2.00E-175ISS
UniRef100_C6TBP8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Adenylate kinase 3 n=1 Tax=Glycine max RepID=C6TBP8_SOYBN SoyBaseE_val: 2.00E-175ISS

Expression Patterns of Glyma05g03120
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g03120
ParalogEvidenceComments
Glyma17g13760 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g03120 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g046100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g03120
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g03120
>Glyma05g03120.1   sequence type=CDS   gene model=Glyma05g03120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAACACTAACTTGGAAGATGTTCCCTCTCTGGATCTCATGACTGAGCTCCTTCGTCGTCTCAAGTGCTCTTCCAAACCTGACAAGCGTCTTATTCTCATTGGCCCACCTGGATCTGGAAAAGGCACCCAGTCACCAATCATAAAAGATGAGTACTGCTTATGCCACTTAGCTACTGGTGATATGTTAAGAGCAGCTGTAGCAGCTAAGACCCCTCTTGGTGTCAAGGCTAAAGAAGCTATGGATAAGGGAGAACTTGTTTCTGATGACTTGGTTGTTGGCATTATAGATGAAGCAATGAAGAAACCATCATGTCAGAAAGGTTTCATTCTTGATGGTTTTCCAAGAACTGTGGTCCAAGCACAGAAGCTTGATGAGATGCTGCAAAAACAAGGAGTTAAAGTTGATAAGGTGCTCAATTTTGCAATTGATGATGCAATCCTTGAGGAGCGAATTACTGGTCGCTGGATACACCCATCCAGTGGCAGAACTTACCATACAAAATTTTCCCCTCCAAAGGTTCTTGGTGTTGATGATGTTACTGGTGAACCACTTATCCAGCGCAAGGATGACACTGCGGCTGTTCTTAAGTCAAGACTGGAGGCATTTCACAAGCAAACCGAACCGGTTATTGATTACTATTCAAAGAAGGGCCTTGTTGCTAATCTTCATGCTGAGAAACCACCCAAAGAGGTGACAGTTGAAGTGGAGAAAGTGCTGTCTTAA
Predicted protein sequences of Glyma05g03120
>Glyma05g03120.1   sequence type=predicted peptide   gene model=Glyma05g03120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MANTNLEDVPSLDLMTELLRRLKCSSKPDKRLILIGPPGSGKGTQSPIIKDEYCLCHLATGDMLRAAVAAKTPLGVKAKEAMDKGELVSDDLVVGIIDEAMKKPSCQKGFILDGFPRTVVQAQKLDEMLQKQGVKVDKVLNFAIDDAILEERITGRWIHPSSGRTYHTKFSPPKVLGVDDVTGEPLIQRKDDTAAVLKSRLEAFHKQTEPVIDYYSKKGLVANLHAEKPPKEVTVEVEKVLS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo