Glyma05g02480 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g02480): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g02480): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g02480

Feature Type:	gene_model
Chromosome:	Gm05
Start:	1836874
stop:	1842261
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma05g02480

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G48210	AT	Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: Kinetochore-Ndc80 complex, subunit Spc25 (InterPro:IPR013255); Has 194 Blast hits to 194 proteins in 72 species: Archae - 0; Bacteria - 4; Metazoa - 72; Fungi - 39; Plants - 62; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). \| chr3:17849435-17851396 FORWARD LENGTH=315	SoyBase	E_val: 6.00E-66	ISS
GO:0000724	GO-bp	Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination	SoyBase	N/A	ISS
GO:0006302	GO-bp	Annotation by Michelle Graham. GO Biological Process: double-strand break repair	SoyBase	N/A	ISS
GO:0006310	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA recombination	SoyBase	N/A	ISS
GO:0006312	GO-bp	Annotation by Michelle Graham. GO Biological Process: mitotic recombination	SoyBase	N/A	ISS
GO:0007059	GO-bp	Annotation by Michelle Graham. GO Biological Process: chromosome segregation	SoyBase	N/A	ISS
GO:0007062	GO-bp	Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion	SoyBase	N/A	ISS
GO:0007129	GO-bp	Annotation by Michelle Graham. GO Biological Process: synapsis	SoyBase	N/A	ISS
GO:0007131	GO-bp	Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination	SoyBase	N/A	ISS
GO:0007140	GO-bp	Annotation by Michelle Graham. GO Biological Process: male meiosis	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009560	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation	SoyBase	N/A	ISS
GO:0010332	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to gamma radiation	SoyBase	N/A	ISS
GO:0016444	GO-bp	Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination	SoyBase	N/A	ISS
GO:0032204	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance	SoyBase	N/A	ISS
GO:0033044	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization	SoyBase	N/A	ISS
GO:0042138	GO-bp	Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation	SoyBase	N/A	ISS
GO:0043247	GO-bp	Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage	SoyBase	N/A	ISS
GO:0045132	GO-bp	Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
KOG4657	KOG	Uncharacterized conserved protein	JGI		ISS
PF08234	PFAM	Chromosome segregation protein Spc25	JGI		ISS
UniRef100_I1K031	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1K031_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q93VK9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Kinetochore protein Spc25 n=1 Tax=Arabidopsis thaliana RepID=Q93VK9_ARATH	SoyBase	E_val: 3.00E-63	ISS

Expression Patterns of Glyma05g02480

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g02480 not represented in the dataset	Glyma05g02480 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g02480

Paralog	Evidence	Comments
Glyma17g09430	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g02480 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.05g040000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma05g02480

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma05g02480

Limit To All Plant Sequences

>Glyma05g02480.2   sequence type=CDS   gene model=Glyma05g02480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGTGCAATCAAGGCAGATGCTAATGAAAAGAGTGACCAATGTTGGGCTGACCTTGCGAGGGTGACGGTCCAGTCTGAAAACGAATGCAAGCAAAACTGGCGGGCCGCTAAATTACCTTCCATATTCAAAAACCTGAAACTGAAGAAAGATCCCGATTGGGAGCGAAGAAAGATGGAGTCCCCAATCTCAATCTGCGACACTGAGATCCCTCTTCAAATGCAGAGCATCGATGCTTTCACCGCTTCTTACGTCAAATCCCTCCATTCCCTCAGAGCCACAGCGCAAGAAACCGCTCGATGTCAAGTTCAACTAGACGAGGTTAAATCTAAACTCAGAGAGACCGAGGATGATTTCGTCAAAGCACTTGCGGTCAAGACCCGCAAAGAGGCCAAGCGAATGGCTTTGATGGATGCTATTGCTTCTGCAAAGGCTAGAGTTGAAGACCTCAATGCATCTATTCAGGAGCAGCGAACCAAAAAGCAAGAATATGCTGCATTTATATCTCAACAATCTCTCGCTTTGGCAGCATCTGAAGGGAAGTTAAATGAAAGCATTGAACAGAATGATGAAACACAGGCCATTTCCTGGTACAATAGGGTCCTTGGTTTTCATGTAAAAGGCGGACGTGGGGTAAAATTCACATTCAAGAATATAAATATGAACAATCCAGATGAGGAGTACTTTTTTACTATCTTCCATGAAAATGATACATACTCATTGTTAAGCTGTGAACATTCCCTCAGGGACACCAAAGAGTTGATCCATGAATTAAACAAGACAAATGATCTATTTAAATTTGTCAGAATAATGAGGAAAAAGTTCCAAGAAGTTGTGGCACAAGGGAATTTAGTTGTGACAAAAGATGAACATGAAGAATCTGCCTTTAACTCTGCTTCTGCTCCAGTTTTATCAATGTCATCTGTTAGAAGTGATTTTCTAGGCAAGGAAAATGAGCATCAAGCTGAACCTATAGAAGGCAATAAACAGTTCAAAAAACAAAATGTTCATAGAAGGCTAAAATCATCAGTTTTATCTCCTGGATCTGCATCATCTGTTCGCCAGTCTCCTCGTTTGAAGGCTAGGAAATAA

Predicted protein sequences of Glyma05g02480

Limit To All Plant Sequences

>Glyma05g02480.2   sequence type=predicted peptide   gene model=Glyma05g02480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MCAIKADANEKSDQCWADLARVTVQSENECKQNWRAAKLPSIFKNLKLKKDPDWERRKMESPISICDTEIPLQMQSIDAFTASYVKSLHSLRATAQETARCQVQLDEVKSKLRETEDDFVKALAVKTRKEAKRMALMDAIASAKARVEDLNASIQEQRTKKQEYAAFISQQSLALAASEGKLNESIEQNDETQAISWYNRVLGFHVKGGRGVKFTFKNINMNNPDEEYFFTIFHENDTYSLLSCEHSLRDTKELIHELNKTNDLFKFVRIMRKKFQEVVAQGNLVVTKDEHEESAFNSASAPVLSMSSVRSDFLGKENEHQAEPIEGNKQFKKQNVHRRLKSSVLSPGSASSVRQSPRLKARK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain