SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g02260

Feature Type:gene_model
Chromosome:Gm05
Start:1665747
stop:1668039
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g02260
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G22220AT Annotation by Michelle Graham. TAIR10: SufE/NifU family protein | chr4:11759444-11760881 REVERSE LENGTH=167 SoyBaseE_val: 1.00E-87ISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005198GO-mf Annotation by Michelle Graham. GO Molecular Function: structural molecule activity SoyBaseN/AISS
GO:0005506GO-mf Annotation by Michelle Graham. GO Molecular Function: iron ion binding SoyBaseN/AISS
GO:0051536GO-mf Annotation by Michelle Graham. GO Molecular Function: iron-sulfur cluster binding SoyBaseN/AISS
KOG3361 KOG Iron binding protein involved in Fe-S cluster formation JGI ISS
PTHR10093Panther NITROGEN FIXATION PROTEIN NIFU JGI ISS
PF01592PFAM NifU-like N terminal domain JGI ISS
UniRef100_B7FHC6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Iron sulfur cluster assembly protein n=1 Tax=Medicago truncatula RepID=B7FHC6_MEDTR SoyBaseE_val: 2.00E-90ISS
UniRef100_UPI00019AF730UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00019AF730 related cluster n=1 Tax=unknown RepID=UPI00019AF730 SoyBaseE_val: 3.00E-116ISS

Expression Patterns of Glyma05g02260
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g02260
ParalogEvidenceComments
Glyma17g09670 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g02260 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g038100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g02260
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g02260
>Glyma05g02260.1   sequence type=CDS   gene model=Glyma05g02260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTGAGAGTGGGCGCAAAGAGGCTTTTGGGAACGACGTCGTTGGGCGTTAGGGTTCCGGCGAGGCTGTACCACGAGAGGGTTGTGGATCACTACGACAACCCCCGGAACGTTGGATCGTTAGACAAGAACGACCCGAGCGTGGGGACGGGTTTGGTGGGGGCGCCGGCGTGCGGCGACGTGATGAAGCTCCAGATTAAGGTCGACGACAAAACCGGAAAAATCGTCGATGCTCGATTCAAGACTTTCGGTTGTGGCTCCGCCATTGCTTCTTCCTCCGTCGCTACTGAGTGGGTGAAGGGAAAGCAAATGGAGGAAGTTCTGACTATAAAAAATACTGAAATTGCAAAGCATCTTTCACTTCCACCAGTTAAGCTCCACTGCAGCATGCTTGCTGAAGATGCCATCAAAGCAGCCGTTAAAGACTATGAAGCTAAGCGTGCTAAGGCAACTGCTAGCGGAGAGGCAGCAACAGGAGAGAAGCCTGCCATTGCATGA
Predicted protein sequences of Glyma05g02260
>Glyma05g02260.1   sequence type=predicted peptide   gene model=Glyma05g02260   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLRVGAKRLLGTTSLGVRVPARLYHERVVDHYDNPRNVGSLDKNDPSVGTGLVGAPACGDVMKLQIKVDDKTGKIVDARFKTFGCGSAIASSSVATEWVKGKQMEEVLTIKNTEIAKHLSLPPVKLHCSMLAEDAIKAAVKDYEAKRAKATASGEAATGEKPAIA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo