SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma05g02100): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma05g02100): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma05g02100

Feature Type:gene_model
Chromosome:Gm05
Start:1521707
stop:1522923
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g02100
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
ATMG00290AT Annotation by Michelle Graham. TAIR10: mitochondrial ribosomal protein S4 | chrM:82028-83116 REVERSE LENGTH=362 SoyBaseE_val: 6.00E-40ISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005763GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial small ribosomal subunit SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF01479PFAM S4 domain JGI ISS
UniRef100_G7I859UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ribosomal protein S4 n=1 Tax=Medicago truncatula RepID=G7I859_MEDTR SoyBaseE_val: 2.00E-45ISS
UniRef100_I1JZZ4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JZZ4_SOYBN SoyBaseE_val: 4.00E-129ISS

Expression Patterns of Glyma05g02100
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma05g02100 not represented in the dataset
Glyma05g02100 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma05g02100 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma05g02100
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g02100
>Glyma05g02100.1   sequence type=CDS   gene model=Glyma05g02100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTTCAAATTGTCTCCGTCCATGCTACTTGGAATTTGTTTTTGGAAGTTAAAGGGAAAAGGAAGTTTGGAAGATGCACTTACTCCGGCGAATTCCTTGTTGGAAGAGAAAATGGTAAAATGAATTATTATAAATTTTTCGCATTATTTTTATTTCTGTGGATTAAGAAAAAACTACCTGCACCATTTCTAGATATAGTACTTCTAAGTACACGAAAGTTGCCCCTTTTTCATGCAGATTTACCCATCACAGAGATGCACAGAGGAACAGAACGAACTTCATATATCCCTTTTCTACTCAATCCAGAAACAAGATCGGACGTTATTCCGGTTCGTCTCCATTTTCGTGAAACTATTCCTCAAGCAAGGCAGCCGATAAGTCGTCGAAGGGTTTGTGTGAATAATCGAATTGTAAGCATTACTCGTTTGAAAGTTTCCCACGGTGATCTGTTTAAACGGAAGGGGTGGTGGCTTCTATTGGACATTTTGAAATGCTTTTGTTCAGTCTTGAATTCTCTTTCACATGAAAAAATATCTCTATGCAAATAA
Predicted protein sequences of Glyma05g02100
>Glyma05g02100.1   sequence type=predicted peptide   gene model=Glyma05g02100   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
FQIVSVHATWNLFLEVKGKRKFGRCTYSGEFLVGRENGKMNYYKFFALFLFLWIKKKLPAPFLDIVLLSTRKLPLFHADLPITEMHRGTERTSYIPFLLNPETRSDVIPVRLHFRETIPQARQPISRRRVCVNNRIVSITRLKVSHGDLFKRKGWWLLLDILKCFCSVLNSLSHEKISLCK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo